SimpleSearch - Line and FST details


Line specific information

 
Line ID 052D02
Vector Used pAC161
Line Availability only available from NASC (N404934)
Segregation Analysis 50:43:41
Confirmed for Hit At5g09860
Parent of DUPLO pair none
Parent of pair(s) 4009, 4040, 9910, 9937, 81680, 81695

Gene hit At1g07260

 
Sequence (A. th genome BLAST matches underlined)
>12-K104556-0022-052-D02-8409
AAATGCCCTTGGCTCCGGGAACTTCTCTGCGATCTCGACCCAAGCCTCGTAGGACTCTCT
CACGAATAGACCTGGAGGCAAAACCTTCGTCGGCACGGAGCAGACGTAGCCAGGAATTGG
ATGTTCTACGTTGCCGGAGCTTAAATCTATGGGATCCTCCCTATAGTGAGTCGTATTACT
CACCCGTTTGGACTTGAATGTAAACACCCTGGGGTATCCCCCCTATAGTGAGTCGAATTA
CTCCCTGGGGTACACTGAATTGGTAACCCCATGGGATCCTGCCTTTTTGTAAGGGATGAT
TATCCAGAGGCGGGAGAGTAGGTAGAATGTGAAACTTAGAGGTGATAAAAGGGGCTTAAG
GGGACAATGGTAGAGAACGGGGAACTGAGAGAGGTGGAGGTGTGATAGGGGTAGAGTGAG
GTGGAGGTTGGAGATGTCGAAAAAATGTAAGAGATGTAACGAGAATGAGGAGAGAAGGAG
AGAGATGTGAGGGACAATGAGAATGGAAAGAGAAAGAAGACTATTGAAGGGGAGGAGAGA
TTTTAAAAGATAGGAAAAGGGAGGAGGGAGAGACGAGAGTGTAAGTGAGAAATGAGAGAC
GGAGGCGAATAGAGAAGTAAGGGAGATAGTGATGGAGAAGGAGAGAGAAACGAGGATACA
GAGGAAAGTATGGTGAGTGAAGAGATGAGGAAGTTATTGAAAGAGAGAAAAAGGGGGCTG
AGAGAGATTGAATAGAGAGAGGTTAGTATTAACAAATAACGAAATAAGA
GenBank Accession FR801458 [GenBank]
Graphic View Graphic view of gene At1g07260
Predicted Position of Insertion Chr1:2228518 - go to primer design
BLAST e Value 5e-72
Hit Clone Code (BAC ID) F10K1
Hit Gene Code At1g07260 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-glucosyl transferase 71C3
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit FR801457 [GenBank]

Gene hit At5g14340

 
Sequence (A. th genome BLAST matches underlined)
>12-K012303-022-052-D02-8409
NTGATCCATGGTAGATTTCCCGGACATGAATGCACTTACAGTTGAATATGAAGAATATAC
TCAAGTGTGTAACCAATGTAAAATAAATAGGACTCACATGTCTTAGAAAGATAGTTGACT
ATGACTTAAAAGGAACATGACTCAACACATATTGGATCTAAATAGAGCTATACGGTGTTA
CGTTCGAGAGAGATTTCATATGAAAAAGCTATGGGATCCTCCCTATAGTGANNNNNNNNN
NNNNNNNNNN
GenBank Accession FR801455 [GenBank]
Graphic View Graphic view of gene At5g14340
Predicted Position of Insertion Chr5:4623926 - go to primer design
BLAST e Value 2e-40
Hit Clone Code (BAC ID) F18O22
Hit Gene Code At5g14340 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 40
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At5g09860

 
Sequence (A. th genome BLAST matches underlined)
>12-K012486-022-052-D02-35St
NACTTGCGTAAGGGATGACGCATTNTCCCCTATCCTTCGCAGACCCTTCCTCTATATAAG
GAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCT
TCGGTTTAAACTACGCCTGAGGAACAGCAAAGACTCGGTGGTTCTGATACAGAAAACGGT
CAAGAGGCCGGTCAAATCGAAGACGGAGAGACAGAAGAAGCTGGTCTGATGGACACTGAT
CTTGATCATCCTCCTATGCCCGTCTCATGAATACGCTTTCAGTTTGTCGACCCTTTCTTC
AATGGGGAATCCTTTGGATATGAAGTTCAAAAGTATTGATGTTTAACAAATTATGTTAAA
AGGTATTTTCTAAATATGTTTGTATGAGTGCAAATCTGCTATGGGATCCTC
GenBank Accession AL753685 [GenBank]
Graphic View Graphic view of gene At5g09860
Predicted Position of Insertion Chr5:3070594 - go to primer design
BLAST e Value 2e-151
Hit Clone Code (BAC ID) MYH9
Hit Gene Code At5g09860 [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear matrix protein-related
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL753684 [GenBank] AL753683 [GenBank] AL753686 [GenBank]


Last Updated on 14.10.2014 10:23