SimpleSearch - Line and FST details


Line specific information

 
Line ID 062A09
Vector Used pAC161
Line Availability only available from NASC (N405865)
Segregation Analysis 50:50:39
Confirmed for Hit At2g34490 At4g03364
Parent of DUPLO pair none
Parent of pair(s) 9558, 61626, 93829

Gene hit At2g34490

 
Sequence (A. th genome BLAST matches underlined)
>65-K016090-022-062-A09-8409
TGATCTGAAATTTCCCGGACTGAAGCCATTTACTGTGATTTCCCGAGGCTGATACAAACT
TTGTACTTAGCTCACACTTACGAGATTATTTACAGCTTTTGATCCATGTATGGAAATCGA
CAATTTCTTCTTGCTACTCACAGAAATGAGACTCTACCCATGCACCTCTCTTAGAGCCTC
GAATAATATGACTATGGGATCCTCTNCTATAGTGAGACTACTTCCTTCTGGTTCAAGCAA
TCCGACACGGCAGGCACTTCCCCTGGCCTCGCTGCTAACTACCTCATCGGCAAATTCATC
ATCTACATCAGAGACACAGAGCTTTCTCATCAAATATTCTCCAACGTTCGTCTTGAAGCT
TTTCACCCTCTATGACATCCTTTGTATAAACAGATATTCGGTGATCATAGCCTAATCTAC
TTGTTTGGTGAGGATCACAAAACTGTTCGCCGTCACCTTGCTCCTAACTTCACCCCCAAG
GCACTCTCCACTTACTCTGATCTCCAACAAATAGTTATGCTCCGTCATCTACGACAGTGG
AGAGGAAAGTTTCTCCGGCGGAACTAAGCCGGTTTCTATGCGAGACCTTGTCCGTGAACT
CAATCTTGAGACTTCTCAAACGGTTTTCGTTGGACCCTACCTTGACAAGGAAGCTATGGG
ACTCCCCCAAA
GenBank Accession AL936910 [GenBank]
Graphic View Graphic view of gene At2g34490
Predicted Position of Insertion Chr2:14537363 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F13P17
Hit Gene Code At2g34490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 710, subfamily A, polypeptide 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL936911 [GenBank]

Gene hit At4g03364

 
Sequence (A. th genome BLAST matches underlined)
>65-K016100-022-062-A09-8409
CTGAAAGCAAACTTTGTATCAAGCTAGAGACTTAAGAGTTGATTTACAGCTTTTGATCCA
TGTTTGGACACCCGACAATGTTTTTGCTACTCAAAGAAATGAGACTTACCATTCAACTTT
ATAAGAGCCAGGAGTAAAATGCCTATGGGATCCTCCCTATAGTGAGACTACTTCCTTCTG
GTTCAAGCAATCCGACACGGCAGGCACTTCCCCTGGCCTCGCTGCTAACTACCTCATCGG
CAAATTCATCATCTACATCAGAGACACAGAGCTTTCTCATCAAATATTCTCCAACGTTCG
TCTTGAAGCTTTTCACCCCCTATGGGATCCTCGCTATAGTGAG
GenBank Accession AL936911 [GenBank]
Graphic View Graphic view of gene At4g03364
Predicted Position of Insertion Chr4:1476682 - go to primer design
BLAST e Value 2e-24
Hit Clone Code (BAC ID) F4C21
Hit Gene Code At4g03364 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification 3' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03