SimpleSearch - Line and FST details


Line specific information

 
Line ID 072B04
Vector Used pAC161
Line Availability only available from NASC (N406832)
Segregation Analysis 50:47:35
Confirmed for Hit At2g31865
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g31865

 
Sequence (A. th genome BLAST matches underlined)
>26-011723-strizhov-B4-oriL
TTGATCCATGTAGTATTTCCCGGACATGAAGACCTTTACATTTAGAATTGCTGTCCCGGA
CACCGGCTTTGTTTCATTAGAGAGGAAAATTCTTCCACTGGAATACCATCCTCACTTTGT
TTCTTATCCCAAGGCTGATTCGTGGGCTAATTCTGCCACCCCACTTTGCTCCATTGAGGT
ATCATACAAACACTCCTATGGGATCCTCCCTATAGATGAGTCGTTATACTCACAGCCAGC
CGGAAGGGCCGAGCGCAAAAGCGGTCCTGCAACTTTATCCGCCTCCATACAGTCTATTAA
TTGGTGCCGGGAAGCTATGGGATCCTCCCTATAACGAGCCGTATTACCCACAATCAACTC
CTGCAGAAGGTAACAAAATACATCAGGGGGTGAAAAAGTTGAAGAATAAAGGAACGAAGC
TTGGTTTCAAAAATCAAGCCAAATTTCATTGACAAAGA
GenBank Accession AL768288 [GenBank]
Graphic View Graphic view of gene At2g31865
Predicted Position of Insertion Chr2:13548461 - go to primer design
BLAST e Value 5e-65
Hit Clone Code (BAC ID) F20M17
Hit Gene Code At2g31865 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation poly(ADP-ribose) glycohydrolase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40