SimpleSearch - Line and FST details


Line specific information

 
Line ID 072G03
Vector Used pAC161
Line Availability only available from NASC (N406891)
Segregation Analysis 100:92:69
Confirmed for Hit At1g10430
Parent of DUPLO pair none
Parent of pair(s) 4722, 4724, 4725, 4731, 8504, 83737, 83760, 83768, 83769, 83770, 83771, 83774, 83775

Gene hit At1g10430

 
Sequence (A. th genome BLAST matches underlined)
>23-011723-strizhov-G3-oriL
TTGATCCTGTAGATTTCCCGGACTGAAGCCTTTACATTGAATATATCCTGAAGCCATGAA
GCCTTTTTACTTTTTTTTCTCATTGTAGATCTGTGTTTTTGGATCATTCCAAAATGGTGA
ATTCTTGGAAAAGTATCCACCTTTTTATTTATCTATGGGATCCTCCCTATAACGGGGTCC
TTTTTACCTCANGGGAACGTTTATTTTTTTTCCGGCGAAAACAAAAGGGGGGTATTATCT
TTTTTTTCGGGTTTGGGAAATCCCCCAAAAGAGGGGGTTCTTTTAAAATTTTTCCCGGCC
CGCCCGGGAAAAACAGCGGTTTTTGAACCGATTTTCTATATTCACCTTTTGGTGGGATTT
CCCGATATTTCTTTTAAATAAGGGGGCCCCAAAAAATATTTTCCCCCTTCTTGCGCGAGC
CCCGGGGGATTTTTTTTTTTAGGAAAAAAAAAAAAGCGCCCCCCNCCTCCCCGGTAATAT
TNATCCCCTTTTTTATTATTTTCCGAGGGGAAAAATATATTTTTTTTTCCCCGCCGCGGG
GGTGGTNTTTTGAGTNAAGAAGAAAAAAAACACAATATCTTTTTTTTTCCTCCCCCCCCG
GGGCGCGCGGAATAAAAAAAAATATNACATTTATTNNTTACTNACTCGCGACGCGCGGGG
GGAGGAGAGNAATNAAATATTCTCCTNACCCATCTGGATTCTATAATTTTATAC
GenBank Accession AL768340 [GenBank]
Graphic View Graphic view of gene At1g10430
Predicted Position of Insertion Chr1:3430152 - go to primer design
BLAST e Value 2e-33
Hit Clone Code (BAC ID) T10O24
Hit Gene Code At1g10430 [TAIR] [MIPS] [SIGnAL]
Gene Annotation protein phosphatase 2A-2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23