SimpleSearch - Line and FST details


Line specific information

 
Line ID 073F01
Vector Used pAC161
Line Availability only available from NASC (N406973)
Segregation Analysis 100:98:92
Confirmed for Hit At1g78540
Parent of DUPLO pair 12513
Parent of pair(s) none

Gene hit At1g78540

 
Sequence (A. th genome BLAST matches underlined)
>06-011724-strizhov-F1-oriL
NTTGATCCATGTAGTATTTCCCGGACAGTGAAGCCTGTACAATTGCAACTGTATATGTAT
TGTGAGCTATCTTCACTACATTAGGAGCCCTAGGCTTTGCAGCTCTCATGCTCTATGGCT
CGCTTGTTGTGTGTATATAGCGATACGGCAAAACAATCTGCGCCTTGTGAAACCTTTATT
ACATAGACCATCAAATCCAACCTAGGTTTGAGTTTCCTTGCTACAGAGACACACAATTCC
TGGACGATAAATCACACCAAAGTCAAAAAGTTTGTAAATTTAGTATGGGATCCTCCCTAT
AGTGAGTCGATTTACTC
GenBank Accession AL768383 [GenBank]
Graphic View Graphic view of gene At1g78540
Predicted Position of Insertion Chr1:29544049 - go to primer design
BLAST e Value 5e-16
Hit Clone Code (BAC ID) T30F21
Hit Gene Code At1g78540 [TAIR] [MIPS] [SIGnAL]
Gene Annotation SH2 domain protein B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23