SimpleSearch - Line and FST details


Line specific information

 
Line ID 076F11
Vector Used pAC161
Line Availability only available from NASC (N407271)
Segregation Analysis 100:63:19
Confirmed for Hit At4g25560
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g25560

 
Sequence (A. th genome BLAST matches underlined)
>86-011920-strizhov-F11-8409
ATGATCCATGTAGCATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTACTTTG
GAATTTCTACCTATATTATATCCCAAATTTTCATAAGAGTAGAATTATATCTGATCTTTG
TAGTTTACTCTAAGCAGGCCCATTTGGTCTTTTCTTAACACCAAGATGGAGGCTCTATCT
GTGGACGTTTGGCGAATATATGTCGGCTCACTCAAATATATGATATGGAGACATGTTTTC
TTGTCTCAGGACAGACAGCTGACTAAAGAGAAATGGCGATAACGAAATATGGAGAGAGAC
ATAGGAAAGGGTGATGGTCACCTGAAGAAGACGAGAAGCTAAGGAGCTTCATCCTCTCTT
ATGGCCATTCTTGCTGGACCACTGTTCCCATCAAAGCTGGACTCTCTTTCATCTTCTTCT
TTATTAGTTTTTAGTTTCTCAAACTGAGTCAACTTTGATAATTGTTGTTGGGATTCAATT
TGATAGGGTTACAAAAGAATGGGAAGAGCTGCAAATTAAGATGGATTAATTACCTAAGAC
CAGGGCTAAGAGGGGATATGATTAGTGCAGAAGAAGAAGAGACTATCTTGACGTTTCATT
CTTCCTTGGGTAACAAGTAAGTGTATCTCTAAGACCTAACCCTATTGTTTTAGCAGATGC
TATGGGATCCT
GenBank Accession AL768702 [GenBank]
Graphic View Graphic view of gene At4g25560
Predicted Position of Insertion Chr4:13052338 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) M7J2
Hit Gene Code At4g25560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 18
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g44110

 
Sequence (A. th genome BLAST matches underlined)
>86-011919-strizhov-F11-8409
NTTTTGATCCATGTAGATCTTCCCGGACCATGAAGCCTTTACANTTGAATATGAGCTGAG
GAGTTATACTTTACTACTTACTAATCTCTCCCTCTCTCTATCTGACTCTTTGATCGGAAA
AAATGGCGGAGAAAAATGCGAGCGCGGCGGACGGTGCAATTAGGGTTAGTGGAATGCAGT
TTTCTTACGATGTTCAAGATCCTATTTTCTTCGATTTTAATCTCGATCTTCCCGCTGGAT
CTCGTTGCCTCTTGGTTGGTGCCAATGGATCTGGTAAAAATTATTCGAATCATTTCGATT
TTGTGTGTGTTTCTGTTTCTGTGAATCTGAAGTAGATCGATTTGGGACCTTGACGAATAT
AGAATGTATTATGTGATTTCGTGTGATTCTGTTTTGGTAGTGTTGGAATTCGGTTTAATT
CGTCGAATTCGACTATATGTATAGAGTTTGAGTAAGTAAGATCGATTTTTCGACTATATG
TATCATGTTAATACTCGAATTTGATTGATTCTGCTGAGAAGGTGATTGTCGTTGCGCGTT
TCATTGACAGGGAAAACTACGTTATTGAAGATTCTTGCTGGAAAACATATGGTTGGAGGA
AAGAATGTTGTACAAGTGCTTGATCGCTCAGCATTTCATGATACAGAGCTTGTTTGTAGT
GGTGATTTGTCTACCTAT
GenBank Accession AL768701 [GenBank]
Graphic View Graphic view of gene At5g44110
Predicted Position of Insertion Chr5:17755737 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MLN1
Hit Gene Code At5g44110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-loop containing nucleoside triphosphate hydrolases superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 07.07.2016 14:03