SimpleSearch - Line and FST details


Line specific information

 
Line ID 077A12
Vector Used pAC161
Line Availability only available from NASC (N407308)
Segregation Analysis 100:99:64
Confirmed for Hit At5g04820
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g04820

 
Sequence (A. th genome BLAST matches underlined)
>89-K016172-022-077-A12-8409
GATCCTGTAGATTTCCCGGACTGAAGCCATTTACAAAACAAACTATCAACTTCAATCATC
GTAATTTTTATAGTTAAGACTTTAGACTAAATAAGTAAAAGCACTTCAAATAACTAACCA
GAAAAAAATGGAAAATTAACAACAAATAGAAAAATATCCCAAAATTAAATAGACACATGA
CCTGACCCCACCAGCTCTCTCTTCTCTCCCCATATATCGCATTCCCTCCAACTCCTTCCT
CTTCCATTAATTACTAAACCCAAACCCAACCAAAGATCTTCACAAAGAAAAAAACAATTG
GTGGTATCAATGGGGAAGAAGAAGATGAAACTCTCTTCTCTGTTCAAAGGCGGAGCCGGA
GGATTACTATGGGATCCTCCCTATAGTGAGACAANTAAATTCTGCATTGTTGATCAAACG
TAAGACACTGGG
GenBank Accession BX890738 [GenBank]
Graphic View Graphic view of gene At5g04820
Predicted Position of Insertion Chr5:1399434 - go to primer design
BLAST e Value 2e-95
Hit Clone Code (BAC ID) MUK11
Hit Gene Code At5g04820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ovate family protein 13
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40