SimpleSearch - Line and FST details


Line specific information

 
Line ID 082D10
Vector Used pAC161
Line Availability only available from NASC (N407822)
Segregation Analysis 100:95:85
Confirmed for Hit At2g34490
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F13F21

 
Sequence (A. th genome BLAST matches underlined)
>76-011867-strizhov-D10-8409
NTGATCCATGTACTATTTCCCGGACATGAATGCATTTACATTTGTATATACTGCCTGACG
GTAATATACATTACTCTGTGACGGTAACTAGCTGACTTNCATTTCCTAAAACATTATTAT
GCACACTGATGTTTATGATTGATCACATTCCCTCTTCTCCTATTTAGGGAACTAACATCA
TAAGTCACAAAAATATAATCTTATGTACGCAGCTGTAGATGAGTTTTTTACTTCTTTGTT
TGACTGATCAACAGAAATTTTAGTTGTATTTAACAAATCTATGGGATCCTCCCTGGAGAG
AGTGGGCTTACATCATTAAAGGTAAATATCTTATAGATCAACATTCAACACACGACACTA
ATTCTTGCTATGGGATCCTCCCTATAGCGAGTCGTTCAACTCANGACNTCAAACAGTCTT
TACCTACTATGGGATCCTCCCTATAGGGAGCCGTATT
GenBank Accession AL768999 [GenBank]
Graphic View Graphic view of sequence AL768999 of line 082D10
Predicted Position of Insertion Chr1:18312440 - go to primer design
BLAST e Value 1e-13
Hit Clone Code (BAC ID) F13F21
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g34490

 
Sequence (A. th genome BLAST matches underlined)
>76-011866-strizhov-D10-35St
CTGACGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGA
AGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTC
GGTTTAAACTATCAGTGTTTTAAGAGAAGATCTAATAAGAAAGAAGAGGAAAAAAAAGGA
TGGTTTTCTCAGTTTCCATTTTTGCCTCTCTCGCTCCGTACTTAGTCTCTGCGTTACTAC
TCTTCTTTCTCATCGAGCAGCTCTCTTACCTCGTCAAGAAACGTAACCTCCCTGGTCCTC
TCTTTGTCCCTCCGATCATCGGAAACGCCATTTCACTCGTCCGTGATCCTACTTCCTTCT
GGTTCAAGCAATCCGACACGGCAGGCACTTCCCCTGGCCTCGCTGCTAACTACCTCATCG
GCAAATTCATCATCTACATCAGAGACACAGAGCTTTCTCATCAAATATTCTCCAACGTTC
GTCTTGAAGCTTTTCACCCTCTATGGGATCCTCCCTATAGTGAGTCGT
GenBank Accession AL768998 [GenBank]
Graphic View Graphic view of gene At2g34490
Predicted Position of Insertion Chr2:14537414 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F13P17
Hit Gene Code At2g34490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 710, subfamily A, polypeptide 2
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03