SimpleSearch - Line and FST details


Line specific information

 
Line ID 089H05
Vector Used pAC161
Line Availability only available from NASC (N408537)
Segregation Analysis 100:95:91
Confirmed for Hit At4g03550
Parent of DUPLO pair none
Parent of pair(s) 9474

Gene hit At4g03550

Sequence (A. th genome BLAST matches underlined)
>40-K016186-022-089-H05-8409
GATCCTGAAATTTCCCGGACTGAAGCCATTTACAATTGAATATATCCTGCATATGTATTC
ATTCTTGCATATTTTGTGCCACAGCCATTTATCAGGTGCGTCTATCAGCTCTCTGGCCTG
GCTCAGTGCAAGCAAAAGCTCATTGCACAACAAGAAACACGGCCAGCGAATAACCGTCAC
ATCCCAGGAATTCTTTGGCAGCTCCAGTAGCTCTACTTCACGATCAGAAACTATATCCTC
TTCTCTGAAAGCTAAGATGATTTCGTTCCAGATCAACGCAAACTTGTTGGCCTCGACCTG
ATTCGACTCAAGTTTCTTAAACGGCCTCCCAAATCCATACCTTAGCTTCAATCTGCATAC
AGTACACAACCTCAAGTTATTACAATATTGAAAAATTTAATTATATGCAGCATCTGCGTT
AACAAAAGCAAAATTTCACAGCTTGTACAGTCAAGTCAAGCGTTGTACAGAAAATTATTT
AGGAATATTAGTAGCATGCTTCCACGGACTACCTATGAATGCCGTCCTTGAACTTGTTAC
CAAAGCCTCTA
GenBank Accession AL937887 [GenBank]
Graphic View Graphic view of gene At4g03550
Predicted Position of Insertion Chr4:1575842 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F9H3
Hit Gene Code At4g03550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glucan synthase-like 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Jacobs et al. 2003, gsl5-1]


Last Updated on 31.08.2016 09:40