SimpleSearch - Line and FST details


Line specific information

 
Line ID 104B08
Vector Used pAC161
Line Availability only available from NASC (N409908)
Segregation Analysis 50:48:27
Confirmed for Hit At1g07705
Parent of DUPLO pair 81
Parent of pair(s) none

Gene hit At1g07705

 
Sequence (A. th genome BLAST matches underlined)
>58-K012183-022-104-B08-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTGATGTGAGTCTTGGTTCGCGGCTAAATTTGGCAGTAAATAGC
GGATCCGGAAATATTGGACAAAATCGCATGATGGGTGGGGTCTTGCCACAAGGTACTTCA
TGATTTATATCCTTTTCTGCTCTTTGTTGAAATAGGTTATGCATTTGTATGGTTTTAGTT
GATTTACAATTCCGTTAGTATTGATGTTAAATCCTTTATCATTAAATGAACAACACCGGA
TTTCTACTATGGGATCCTCCCTATAGTGAGTCGATTTACTC
GenBank Accession AL755984 [GenBank]
Graphic View Graphic view of gene At1g07705
Predicted Position of Insertion Chr1:2382961 - go to primer design
BLAST e Value 1e-124
Hit Clone Code (BAC ID) F24B9
Hit Gene Code At1g07705 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NOT2 / NOT3 / NOT5 family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL755984 [GenBank]


Last Updated on 31.08.2016 09:40