SimpleSearch - Line and FST details


Line specific information

 
Line ID 106G06
Vector Used pAC161
Line Availability only available from NASC (N410158)
Segregation Analysis 100:96:93
Confirmed for Hit At5g54250
Parent of DUPLO pair 2398
Parent of pair(s) none

Gene hit At5g54250

 
Sequence (A. th genome BLAST matches underlined)
>47-K012378-022-106-G06-8409
NTGATCCATGTAGATTATCCCGCACATGAATGCCTTTACAATTGAATATATCTCTGCCAT
CGATAATCCAGTGGACCCTGCGTATCGTTGCACGGCATTACTCTTGTATCCTCCCTATCC
TTAGGCTCCTTAACCAACCTTTTGTCCCTATCGCAACAATTTGGATTCATTTCAAGATTG
CTCGTCGGTGGCCTTACTCCGGCAGTGTATTGTGACTGCGACCACCACACAAGGAGGATG
GACACCATGGCTATACGAGGGACTGCTCCACCTTACATTTTGGATGATGGGCACTGTAAG
AGATCTCTGAGGCAGATCACCAATGCCTAAGGTTTACTATGGGCCCCTCCCTGAAGATGA
CTATTTTACTGAGAACTGAGTTAATTGTTTGGAAGTGTCTTTTATATTAGGTGTAATCAT
TGGCATGAGCTTCTATCTTAATCCCTTCCTA
GenBank Accession BX546533 [GenBank]
Graphic View Graphic view of gene At5g54250
Predicted Position of Insertion Chr5:22029641 - go to primer design
BLAST e Value 3e-20
Hit Clone Code (BAC ID) MDK4
Hit Gene Code At5g54250 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cyclic nucleotide-gated cation channel 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23