SimpleSearch - Line and FST details


Line specific information

 
Line ID 108H07
Vector Used pAC161
Line Availability only available from NASC (N410363)
Segregation Analysis 100:94:85
Confirmed for Hit At1g61060
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g61060

 
Sequence (A. th genome BLAST matches underlined)
>56-K012313-022-108-H07-8409
TTGATCCTGTAGATTTCCCGGACTGAAGCCTTTACATTGAATATGTCCCTTAACGACCTT
TACCGCCGTCGCCCTAAGTTTGGACTACTAATATGAACCGAATGATCTGAAGCCAAAAAA
AAGCTGCATCTGCCCATGTCGAGCTTGAGAACAACACCTTTGAGAATCGCCGTGGCTGAA
CAACAATACTACAACCATCTTCACAGATTCCTTGGAGTAGCTATGGGATCCTCCCTATAA
TGAGCGTGGGACTCATNAGATGTGGCAACTCTTTCTTAATCTCGGTTATTCTCAGTGTGG
GCAATGCTAAAAACTCTCCTGTGATGGGATTAGAAATCACCAGCACTCTTGAATAATTCT
TTCGATCATGTACAAGACATAACAATCCGCCAACAGGAGGACTTGTTATAAGTAAACTGT
TTCCACTTGTCCTATGATGAAGGGTGGCTACAAGAGACGTGTTCTCATCATGGTTTCGAG
GCTGAGGTGAAGTGTACAAGAACAACCCTTCTGCATTTTCGATGGTGAAAAGGATCCGCG
GTGGGGGCTGGAGACATGATCGGGAACAACATGTTGTAATATGGACGACGAATTTGTGAT
GACCATAGCTTTGATACCCAACGACCCTGAACTATAGACTTCACTGGGCAGTTCGACCAG
ATCTTAACAGTGAAAAAAAACAACTTGGATAGCCTCAAAATAATTCTGTTTCCGCGCCCC
CCAAAGGGTGGGGACCTCTTAAGGTTCATGGGGAATGGATAAAAGGTCAAA
GenBank Accession AL756413 [GenBank]
Graphic View Graphic view of gene At1g61060
Predicted Position of Insertion Chr1:22489025 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T7P1
Hit Gene Code At1g61060 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40