SimpleSearch - Line and FST details


Line specific information

 
Line ID 117B05
Vector Used pAC161
Line Availability only available from NASC (N411153)
Segregation Analysis 100:99:77
Confirmed for Hit At5g47120
Parent of DUPLO pair none
Parent of pair(s) 12695

Gene hit At5g47120

 
Sequence (A. th genome BLAST matches underlined)
>34-K012519-022-117-B05-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAACATGACATGGGTGT
ATCACATCTCTGGGACGTCTTCTGCTAAGGGGAGCATGACTGACGAACAGGAGGATCTTA
ACAGGTAGTAAGCTAGGTAAAGTATAACGAAAGATCTCCACAGAATCATAGTCAAGTAAG
CATCAACAGACTAAATCAGTGGAAAGACCCAATTAGAAACCCTATGGGATCCTCCCTATA
GTGAGTCGTTTTACTCAACCCAACCCATTATTGAATTGGCTGCTGTCTTATTGGACTAAA
GTTTCGCCTTCCTGACATTGGTGTTCGTTTCGATGCAGCAAAAAAGGCTTTCTCTTCTGT
TTGTGTCTGCTGTTCTTGAATGTGCTTCTGTTGGCCCCTTGATCAGAGTGGCAATTGCTG
TTGACCCAACGTGTGTTATGGTTATGCAATTTGATTCTTGTGGATACATGTTAATTGTCT
GTTAGACTATTCTATGGGATCCTCCCTATAGCGAGTCG
GenBank Accession AL757063 [GenBank]
Graphic View Graphic view of gene At5g47120
Predicted Position of Insertion Chr5:19136544 - go to primer design
BLAST e Value 3e-88
Hit Clone Code (BAC ID) K14A3
Hit Gene Code At5g47120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BAX inhibitor 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03