SimpleSearch - Line and FST details


Line specific information

 
Line ID 125A07
Vector Used pAC161
Line Availability only available from NASC (N411911)
Segregation Analysis 102:101:80
Confirmed for Hit At1g16210
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g16210

 
Sequence (A. th genome BLAST matches underlined)
>49-K104604-0022-125-A07-8409
ATTGAATACATCGCTTGATCCAAAGTTTAGAGGGCCGCTTAACGGTTCAACCAACTTAAT
CCGAGAAAAGCCCAAGTTTTGATGGAGTTTGGGAAATTTGAACTATTTTAAATTGGCAAT
AACCATAATTTAGTTTGCTTTGTAAAGTAATTGATCACACACTATAGACTTTTACTTCTC
TTAGACATTAGGTTTTGATAGGAGGAGAATCTATGGGATCCTCCCTATANTAAATCGTAT
TACACACTACAACATGGAAACAAATTAGCGAAGAGATAAGAAAAAAATCGTGGAGAAACC
AGAGATAGGAATTACAAAATAAAACACAGCGAAAGAAGATAAATGGACATGAAGAAAGAA
TAGATGTAAAGGAAGAGAGAATATAGAAACAAAACGAAAGCAAGAATGAAGAAGTATAAG
GAACGAAAAAGAAATAAAATAAAGAGATGAAAATGTAGAGAAAAATAATGTAGTAAGTAA
GAAGAAGAAAAAAGAAAAGAAATGAGAAAAAAGAAAATAAAGAGTAAAAAACAAAAGAAA
AAAAAAAGAAAAAAAGTGAGGAAAAAGAGAAAAAAGAGAGAGGATGTTTAATAGAATTAA
GAAACATAAGAAGAAGAGAAGAAAACAAAATGAAAAAAAAAATAGTGAAAGCAAGAATAA
ATAAAAAAGAATAAGAAAAGAGAAAAAGAAAAAAAAGAAAGACGTAATAAAGAGAGAGAA
ATTAGAAAATATAGACAAAAGAAAAAACAAAAGGAAGAAAAGAGCTGAAAAAAGAGGTGG
AAAAAAGGAAGAACAGATAAAATAAAAAGAAAGCAAAAGAAAAAAAAACAGTAAAGAGAA
AATAAAAAGAAGGGAAAAAGGAATTAAATGAGAAAAAAATAAAAGTAAAAGAAAAAAAAA
AAGATAGAGGAAGAAAAGAAATAGAAGGACAGAATAAGAAAAAGAAAGAAGAGACAAAGG
AATCTATATAAAACATTATTATAAGTACAGAGAAAAAGAACAGTAAGGACATAAGAATGA
ATGATAAATAAAGAAGGAAAAATGAAGAAAAAGTAAAATATAGAAATAGAATAAAGAATC
AAATAGATAAAAATACAAATTGGGAACGATAATGAAGGAGAGATTAGAGAAAGAGAAATA
GAAAATTATAGAAGGTAATGGAGAGAAAAAGGCATTTAAAAATGAAAAGTAGAAAAAAGA
CAGAGAATAAGACATATTAAAATGAGGCGCACATAGTAAGCATAGTGAGCAAGAAAAGAA
ACAAGGAGAGAGTAGATGGAAAGGAACAAGAAAGAAGGATTATGAAGAGATAAATAGGAA
AATAGATCGAAGAGGAGGTAAGGTAACGAGACAGAGAGAAGAAGAGAAGATAGATGTGGA
AGACGAAATATGAAATATTAGAGACAAGATATACATATGTATAGGAATAGAAAACAGAAT
ATATAATAATAACGGTGAGACAAGAACAGAGAAGAACAGCGAT
GenBank Accession FR803560 [GenBank]
Graphic View Graphic view of gene At1g16210
Predicted Position of Insertion Chr1:5547704 - go to primer design
BLAST e Value 6e-106
Hit Clone Code (BAC ID) F3O9
Hit Gene Code At1g16210 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation coiled-coil protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL764370 [GenBank] FR803557 [GenBank] FR803560 [GenBank]


Last Updated on 31.08.2016 09:40