SimpleSearch - Line and FST details


Line specific information

 
Line ID 143G10
Vector Used pAC161
Line Availability only available from NASC (N413714)
Segregation Analysis 100:10:10
Confirmed for Hit At5g59300
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g59300

 
Sequence (A. th genome BLAST matches underlined)
>79-K012977-022-143-G10-8409
TTTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATCCATTTAC
ATTCGCTGACTACGGGCGCACCATCGCACCTGGAAATACTTGCTAAACGCAATCTCCATA
TATGGAAACCCGTGCAAAATTTGGCAGTCAGTGACAGCCTTAGACCGGAAGGTTCTAGCA
TGCCTATGGGATCCTTTCTATAACGAGTCTTTCTAATCACGCCATTCTTTCTGCGCAAGA
GAAAACACACAAAATCCATAAGCATGTTCTGCTCTTAATTGCAAGCTATGTGCGATAAAT
CGATTGAAATACTCACGGCAGCTTCAACATTTGCTGGAGACTCATCGTTAGGACCAGAAA
GCATTGATATGATACTCAACATAATACTCTCAACCTGAAAGCACCATAATTTGTTTCACT
ACGGCATGAACATCTGAGACATGAAATAAATCACCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL765814 [GenBank]
Graphic View Graphic view of gene At5g59300
Predicted Position of Insertion Chr5:23919774 - go to primer design
BLAST e Value 8e-132
Hit Clone Code (BAC ID) MNC17
Hit Gene Code At5g59300 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ubiquitin carrier protein 7
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23