SimpleSearch - Line and FST details


Line specific information

 
Line ID 149H12
Vector Used pAC161
Line Availability only available from NASC (N414304)
Segregation Analysis 50:30:23
Confirmed for Hit At4g12330
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g12330

 
Sequence (A. th genome BLAST matches underlined)
>96-K013072-022-149-H12-8409
NTTGATCCATGTAGATTTCCCGTACTGAAGCCATTTACATCTGAATATATCCTGAAGGTA
GACAATATGCCATCAGAGTGCTAAGATAATGACGCTAGCAAAGTACATACGTACTCATGC
ATGCTGTGTTAGGACACGTATGGGAAGCTCACTATACAGTGGCAACGGCCCATCGACATG
GTACATGGACATGTTTTCATCTTCATCCTTAGCATTCAACAAAACCATCAAAAAATCTCC
ACCGAGCCCTTCACTATCCTTATCCATTTTTATCCGTTGACTTATAATCCGGTCGAACAT
CCGGTCCATCCTCTGAGCCTATATACACTCGCACTCCTCCTATCGCGGGCGGTATTACCA
ACTGAGAACCGGATAAAACACAGAGACATTTGACTTTACCACAACATCAATTATTTCCGT
AATCAATTCCAAAAATTCAGCTCCAACTTTCTGTCTCTCCTCGGCAACCGCAACAAGTTT
TCCCCACAACATCTGAGCCACCACATTTAATATCGGGACAAATATTTGGTTTGCCAACGT
TAACCCGACAACCCGGGCCCGAGCCC
GenBank Accession AL757546 [GenBank]
Graphic View Graphic view of gene At4g12330
Predicted Position of Insertion Chr4:7318622 - go to primer design
BLAST e Value 2e-92
Hit Clone Code (BAC ID) T4C9
Hit Gene Code At4g12330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 706, subfamily A, polypeptide 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03