SimpleSearch - Line and FST details


Line specific information

 
Line ID 165D04
Vector Used pAC161
Line Availability only available from NASC (N415784)
Segregation Analysis 100:76:60
Confirmed for Hit At4g14920
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g14920

 
Sequence (A. th genome BLAST matches underlined)
>28-K013365-022-165-D04-8409
CTGATCCATGTAGATTATCCCGGACATGAAGTCCTTGCATGTTACACATCAAACGATCCT
GCACATGGGTCAATCTTAAATATGTGAAAGCCTTTTGCATCACCAAACTGAGAAGTCTAC
TGGTTCCTCCTCTCACCGTGTGGATGGAGGGAAAAGTAGCAAACATGGTAGGAGTACACT
GTTGGTGCGGCGTTCAGTCAGAGGAGATAATTCAAAGAGTGATGGTTTTGTACCCTCATC
TGAAAAACGGACGGTACTGGCATGGCTTTTTGATAGTGGAACCTTACAGTTGAGTGAAAA
GGTAAGGGTGGGGAACCAACGCCGGCCCCGCGCCATGCTTGAGGGTTGGATAACACGAGA
CGGGATTCACTGTGGTTGCTAAAATAAAAAACTTGCGGCTGCCAAGTGTGAGATACATGC
TGG
GenBank Accession BX511292 [GenBank]
Graphic View Graphic view of gene At4g14920
Predicted Position of Insertion Chr4:8534300 - go to primer design
BLAST e Value 2e-135
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g14920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Acyl-CoA N-acyltransferase with RING/FYVE/PHD-type zinc finger protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03