SimpleSearch - Line and FST details


Line specific information

 
Line ID 168A02
Vector Used pAC161
Line Availability only available from NASC (N416034)
Segregation Analysis 50:50:38
Confirmed for Hit At2g18570
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g18570

 
Sequence (A. th genome BLAST matches underlined)
>09-K013363-022-168-A02-8409
CTGATCCATGTAGATTNTCCCGAACATGAAGCACTTTATACAGAAACTAGCAACTAAAAA
GAAAAGTAAGGGGTCGACCATCGATCATGGACCAGCCTCACGCGCTTCTATGGGATCCTC
CCTACTGGGATGAACCGAATCCCTATCCTGGAGCTCGCGAACCGTCTCTCCTCCGTGCTA
AACATCCCGTAACCATTCTCGCGGTCACCTCCGGCTCCTCTTCACCGACAGAAACCGAAG
CCATACATGCAGCCGCGGCTA
GenBank Accession AL759349 [GenBank]
Graphic View Graphic view of gene At2g18570
Predicted Position of Insertion Chr2:8063382 - go to primer design
BLAST e Value 6e-68
Hit Clone Code (BAC ID) F24H14
Hit Gene Code At2g18570 [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23