SimpleSearch - Line and FST details


Line specific information

 
Line ID 172B09
Vector Used pAC161
Line Availability only available from NASC (N416437)
Segregation Analysis 100:97:71
Confirmed for Hit At3g22670 At5g07580
Parent of DUPLO pair none
Parent of pair(s) 1826, 2446

Gene hit At3g22670

 
Sequence (A. th genome BLAST matches underlined)
>35-K119006-0022-172-B09C-8409
TAATAACGCTGCGGACATCTACATTTTGATTCACGGTTTTTGTAAAGCTCGGAAATTTGA
TGATGCTAGAGCGATGATGGATTTGATGAAGGTTACTGAGTTCACTCCTGATGTTGTTAC
TTACACTAGCTTTGTGGAAGCTTATTGCAAGGAAGGGGATTTTAGGAGGGTTAATGAAAT
GTTGGAAGAGATGCGAGAGAATGGGTGTAATCCTAATGTTGTGACTTATACTATTGTGAT
GCATTCTTTGGGTAAATCTAAACAAGTAGCTGAAGCTTTAGGAGTGTATGAGAAGATGAA
AGAAGATGGTTGTGTTCCTGATGCTAAGTTTTATAGCTCATTGATACATATTTTGTCGAA
GACTGGTAGGTTTAAGGATGCAGCTGAGATATTTGAGGACATGACGAATCAAGGAGTTCG
TCGTGATGTTTTAGTCTACAATACCATGATTTCCGCTGCGCTTCATCACTCACGAGATGA
GATGGCTCTACGTTTGCTTAAAAGGATGGAGGATGAGGAGGGGGAATCATGTAGTCCAAA
CGTTGAGACTTATGCTCCATTGTTGAAGATGGTTGCCATAGAAGAAA
GenBank Accession LM644493 [GenBank]
Graphic View Graphic view of gene At3g22670
Predicted Position of Insertion Chr3:8018641 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MWI23
Hit Gene Code At3g22670 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pentatricopeptide repeat (PPR) superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g07580

 
Sequence (A. th genome BLAST matches underlined)
>66-K013458-022-172-B09-8409
CTGTCCAATTGTAAATGAAGCCATATGGACCATCATATTTAGGGTAGCCATTTAAAAGCC
GTGCTCAACTTCCCTCTTGACGCCGGGAAATATGAAGCTCCAGCGAATTCTGGAAGGAAA
AGGAAGAGAAGTGATGTGCATGAAGAGCTTCAAAGAACTCAGAGCAATTCATCTTCATCT
TCCTGTGATGCATTTTAGCATATTAAGAGTGTGAGCAGTTTCCTTAAGTTGTATAAAGTA
ATCGTACAGAGGAAACGAATTGTGTATGTTTAGTGTGCTTGCAAGTTGCAACAAATGTGT
CTGGATGTTCTGTTTCTTCATGTCCCTAAGATTTAGAAACATCTTCTTATTTCCAAGAAA
GTTATTCAGTTTCCAGGTCTCTAAACAACCTCACTATGGGATCCTCCCTTGGGGGAGGAG
GG
GenBank Accession BX546568 [GenBank]
Graphic View Graphic view of gene At5g07580
Predicted Position of Insertion Chr5:2400153 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T2I1
Hit Gene Code At5g07580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ethylene-responsive transcription factor
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40