SimpleSearch - Line and FST details


Line specific information

 
Line ID 198F06
Vector Used pAC161
Line Availability only available from NASC (N418978)
Segregation Analysis 100:95:77
Confirmed for Hit At2g22330
Parent of DUPLO pair none
Parent of pair(s) 3868, 4234, 4283

Gene hit At2g22330

 
Sequence (A. th genome BLAST matches underlined)
>46-K014762-022-198-F06-8409
GTTATCGCCGTACCTAACGCCGGAGCATTACATCCTCTCTTTCCGGTACTAAACGAGATA
AAACGGAGATCTTTCTCCGTCAAAGTCACTTCCGAACACTGATTGAGATGCCTTTCTGGT
TTGAAGCTAAGTGGATCAGACCAAACCTTGGGGTTACAACCAAGACCGTAACGGCTAAGT
AAAACTTGACTTCCTTTATGAATATGGGAACCTGCGACGGACGTATCACAAAGTGCCACG
TGTGGGAGGTTGAAGGCCGCCACGGGATGAACACCGAAAGCTCCTCGGATAATAGCTTTA
ACATAGATAAGATATGGTGTATTCGATTCTTGGACGAATCTTTGTTTTCCCACGAATCTA
TCGATCTCTTCCATAGATTTGAGGACGATATCCGGTTTGTTTATCAATTGGAAATGGCTT
CATGCGCGGGAAATCCTACCTGGATCATCAATGAGTATCCAGCGCAATATGGAGAAAAGC
TAAGAGTCTCACCACTTCTTTTTC
GenBank Accession BX890875 [GenBank]
Graphic View Graphic view of gene At2g22330
Predicted Position of Insertion Chr2:9490817 - go to primer design
BLAST e Value 3e-165
Hit Clone Code (BAC ID) T26C19
Hit Gene Code At2g22330 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 79, subfamily B, polypeptide 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR396387 [GenBank]


Last Updated on 14.10.2014 10:23