SimpleSearch - Line and FST details


Line specific information

 
Line ID 208G05
Vector Used pAC161
Line Availability only available from NASC (N419949)
Segregation Analysis 100:93:72
Confirmed for Hit At5g24520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g24520

 
Sequence (A. th genome BLAST matches underlined)
>39-K014551-022-208-G05-8409
TTGATCCATTGTAGATTTCCCGGACATGAAGCTATTTACAATTGAACACGGCCCGCTCAT
CGTGGTTATTGCCTTTTGAGAGAGCAGAGGAACATCCAAAGGTCTTGGTATTCTGCATAT
TGTAGAGATACCGATAAATAATCAATGGAGACGGTGTACATATAAACCCTCTGGATTAAT
CAGTATCTTTTAATGTATCTATTGATAATGGGCTTCTGTATATTCACATAATGGGCCTTT
TATTTTAACGCTAAGAGCTATAGAATGGCCTAATTATTGGATCGCTAAGGGATCCTCCCT
ATAGTGAGACCTTTCTGTCTCCTCCACCCGACGGCTCGCCCCCAAAACTCACCTTCCACC
ACCAATAGCATGC
GenBank Accession AL766238 [GenBank]
Graphic View Graphic view of gene At5g24520
Predicted Position of Insertion Chr5:8372760 - go to primer design
BLAST e Value 1e-68
Hit Clone Code (BAC ID) T31K7
Hit Gene Code At5g24520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transducin/WD40 repeat-like superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL766239 [GenBank]


Last Updated on 07.07.2016 14:03