SimpleSearch - Line and FST details


Line specific information

 
Line ID 211A01
Vector Used pAC161
Line Availability only available from NASC (N420161)
Segregation Analysis 100:94:87
Confirmed for Hit At1g26700
Parent of DUPLO pair 2776
Parent of pair(s) none

Gene hit At1g26700

 
Sequence (A. th genome BLAST matches underlined)
>01-K014136-022-211-A01-8409
NTGATCCATGTAGATTGTCCCTTACATGAGAGCACTTTACAATTGAATATATCCATGTAG
ATATGTTCATATATTGGCATAATCTATTCTTGTTTCTTCAGTGGCAATTTGGATACAATT
CTTGCTTCCTAAGGAACCATTTACTTGTCTACTTGCGACTTATCCTATGGGATCCTCCCT
ATAGTGAGATGAAGACACAGAAAGCACATATATATGTTATTACAAAACAACAAATTCCTT
TGTGACTGATATAGTTTGCAAAGAATCATACAGACCAGAAACTGAATGAGGTGGATAAAG
GATAAGAGTAATTCCGGATTCTTCAACCAAAAAAGTTCATCGCGAGGTCTCAGCTATATA
CCAGAAGCATATACTGTTATACTA
GenBank Accession AL766454 [GenBank]
Graphic View Graphic view of gene At1g26700
Predicted Position of Insertion Chr1:9231523 - go to primer design
BLAST e Value 4e-75
Hit Clone Code (BAC ID) T24P13
Hit Gene Code At1g26700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Seven transmembrane MLO family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL766453 [GenBank]


Last Updated on 31.08.2016 09:40