SimpleSearch - Line and FST details


Line specific information

 
Line ID 212D10
Vector Used pAC161
Line Availability only available from NASC (N420302)
Segregation Analysis 50:27:19
Confirmed for Hit At5g44380
Parent of DUPLO pair none
Parent of pair(s) 6559, 6583, 6595

Gene hit At5g44380

 
Sequence (A. th genome BLAST matches underlined)
>76-K014133-022-212-D10-8409
ATTGCCGTTCTTTATATTTGTATGAAAAATTATATAAACAATCATATTTGTGATATATTT
AATACTTTCTATAGCATCCTCCCTATAGTGAGACTGAC
GenBank Accession AL766631 [GenBank]
Graphic View Graphic view of gene At5g44380
Predicted Position of Insertion Chr5:17880844 - go to primer design
BLAST e Value 1e-25
Hit Clone Code (BAC ID) K9L2
Hit Gene Code At5g44380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FAD-binding Berberine family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40