SimpleSearch - Line and FST details


Line specific information

 
Line ID 227B07
Vector Used pAC161
Line Availability available as T3 set from NASC (N421715)
Segregation Analysis 50:44:33
Confirmed for Hit At4g39400
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g39400

 
Sequence (A. th genome BLAST matches underlined) 
>50-K014266-022-227-B07-8409
CTGATCCATGTAGATTTCCCGGACATGAANGCCTTTACAATAACCGAAAAAAAAAGGCGA
CTGCGGAAGCGATTCTGGCTTGAACCCACACCTACCTTTTCTTGGAACGATTCCGGAAAA
AAAGTTTAAACAATCCCTTTTTTTCGTTTCCAATTTTTTCGCCGGGGGGACGCACGGTTT
TATAAAAAACATGGGACCAAGAGGAGTGTTGTGGAGCTCCCCCTTACTCGACCCAAAAGG
AGTTAGATCCGAACATTTTAACCGGCTTTCAACGATGAACCCTTG
GenBank Accession FR806120 [GenBank]
Graphic View Graphic view of gene At4g39400
Predicted Position of Insertion Chr4:18326503 - go to primer design
BLAST e Value 4e-07
Hit Clone Code (BAC ID) F23K16
Hit Gene Code At4g39400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich receptor-like protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR806120 [GenBank]


Last Updated on 10.06.2021 13:37