SimpleSearch - Line and FST details


Line specific information

 
Line ID 227H02
Vector Used pAC161
Line Availability only available from NASC (N421782)
Segregation Analysis 50:36:34
Confirmed for Hit At3g16940
Parent of DUPLO pair 2316
Parent of pair(s) none

Gene hit At3g16940

 
Sequence (A. th genome BLAST matches underlined)
>16-K014266-022-227-H02-8409
NTTTGATCCATGTAGACTTTCCCTGGACATGAAGCCTTTACATGAGGCTATGTACAGCAA
ATGCGGTACGCACGAACCGAGTACTCTATAAAGATGCTCTTGCTAAGTCTGATCCACTGA
CATTCAGCTCCATATCTCACTCTACAACATGTATTGACCTAAACACTGTGAACCTAGTGG
GATGCTACCTATGAGAGAGCGACAGTGGCTGATGGATCTCTTGATGCTTTGCTTAACGAT
GGTCCACAAAGACGAGAGAGTTTTGGAAGGTGGATGAATTCATTTATCAGCGAATCTAAT
GGCTCACTGGAGGATCCTTCCTTTGAACCCATGGTTATGCCTATGGGATCCTCCCTATAG
TGAGAACTTTAAACTTTTTATATAAGCCCTTGTTGACGCTTAATTCGTTTAAATTTGGTT
AATACTGTAATAATACGTACTTCTGCCGCCTGTGAGAGAGACACCCTCTAAATGGTGGGG
AAGACTGTTCTCTTTGCAGCTAAAGTCTTCCATATCATAAA
GenBank Accession AL761725 [GenBank]
Graphic View Graphic view of gene At3g16940
Predicted Position of Insertion Chr3:5783645 - go to primer design
BLAST e Value 6e-74
Hit Clone Code (BAC ID) K14A17
Hit Gene Code At3g16940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation calmodulin-binding transcription activator
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03