SimpleSearch - Line and FST details


Line specific information

 
Line ID 233H02
Vector Used pAC161
Line Availability only available from NASC (N422358)
Segregation Analysis 50:46:40
Confirmed for Hit At1g13030
Parent of DUPLO pair none
Parent of pair(s) 9570, 97508, 97514, 97522, 97525, 97529

Gene hit At1g13030

 
Sequence (A. th genome BLAST matches underlined)
>16-K014315-022-233-H02-8409
TTGATCCATGTAGATTNTCCCGGACATGAANGCCTGTAAATTGGTAATTTTTAAAATGAT
TTTCAAGAGTTTCACAGTGCTTTTCCTTGGTTGCTTGAATATATACAACCAACTGCGTCT
GTAGAAGCTGCAAATCATGTAACAATAAAGAAGATATAAGTGTTGAAGCGCAGGCTGTAC
ATCACTAAAACACGTGATGCATACATAAATCTTATCATTTTAAGTTTAAAGTATTTGATG
AAGAACCTCTTCCTTCTCTATGGGATCCTCC
GenBank Accession AL938288 [GenBank]
Graphic View Graphic view of gene At1g13030
Predicted Position of Insertion Chr1:4445738 - go to primer design
BLAST e Value 2e-83
Hit Clone Code (BAC ID) F3F19
Hit Gene Code At1g13030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sphere organelles protein-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g44980

 
Sequence (A. th genome BLAST matches underlined)
>16-K014319-022-233-H02-8409
CTGATCCATGGTAGATTTCCCGGACATGAANGCCTGTACATTGGAATATTATCTCTGATG
ATCCATAATAGTTGACTGTTGCTCATAAATTGTGCGTTTGACATACACATGCTGCTGTCC
ATGATCAAACCTGCGTACCGAGCAACTCCATTAATCAATTTCGAGAACCTTCACAAGCTG
CACACGACTTCATGACACTGTATTGTCATAGCTAGACTCTGATCTTAAACTGCATAAAGC
TGTCCATGAACATTACATAGATTCCTCTATGGAACACGTATATGTGAATAGAAGGGTGAA
TAATTCGAGTCCAGGAACGTTTAACCAAAGATTTCTCCATCTCTTCGATAACACGCTTGT
CTTAACAGAATCTTTGGTTCGAAGCTCTAAGAGTATCTGAGTTAGTAAAGAATCCGGCAA
TTCGCTGATATAATCGCGATCCATCCCTATGGGATCCTCCCT
GenBank Accession AL938289 [GenBank]
Graphic View Graphic view of gene At5g44980
Predicted Position of Insertion Chr5:18160985 - go to primer design
BLAST e Value 7e-89
Hit Clone Code (BAC ID) K21C13
Hit Gene Code At5g44980 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box/RNI-like/FBD-like domains-containing protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03