SimpleSearch - Line and FST details


Line specific information

 
Line ID 235B06
Vector Used pAC161
Line Availability only available from NASC (N422482)
Segregation Analysis 100:85:53
Confirmed for Hit At5g21170
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g21170

 
Sequence (A. th genome BLAST matches underlined)
>42-K014334-022-235-B06-8409
TGATCCATGTTACCTTGACTTTTACGTGCTGATCCATGTAGATTTCCCGGACACCTTTCA
TAGTTGGATAGGATCCAAGTACATAACCTCCAGCCTTTTTTTTATGAGTGAACTCTACTT
GTTCACTTGATTTGTGTTATCCTGTTGGTTCTTGAGAATTTGTAATGTAGATTCTTGTTC
TTAAAGCTTTTTTCTGAGTTGGGTTTAGAGATTCTGTACTATGGGATCCTCTGTATTCTG
CCATTAGCGGGGTGATTTTTTCCCGACGGGCGGTAAAACCGGGGAA
GenBank Accession AL938454 [GenBank]
Graphic View Graphic view of gene At5g21170
Predicted Position of Insertion Chr5:7206100 - go to primer design
BLAST e Value 3e-63
Hit Clone Code (BAC ID) T10F18
Hit Gene Code At5g21170 [TAIR] [MIPS] [SIGnAL]
Gene Annotation 5'-AMP-activated protein kinase beta-2 subunit protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23