SimpleSearch - Line and FST details


Line specific information

 
Line ID 254B10
Vector Used pAC161
Line Availability only available from NASC (N424310)
Segregation Analysis 50:36:23
Confirmed for Hit F15O5
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F15O5

 
Sequence (A. th genome BLAST matches underlined)
>74-K014575-022-254-B10-8409
TGATCCATGTAGATTTCACGGTTACTGGTTCTATTGTTTTTTATATGAAGAACTTTTTCC
AACAACAAAAAGTCTGTAAATTTAGCTTAGGGGAAGAAGAGTCATCCAATAATTTCGTGT
TAAAAAAGTCTGTAAATCCTCTTCTTCCCAAGTGTTTGAACCCCTACATAAAATAAATTC
CTTTACTGTATGTGCAAATGTCTCTCTAGCTGTGGGATCCTCCCTGAGGTGAGAAATCAC
GACCGTCGATTTCATTTATGTCAAGGGGCAAAACTGAAAATCACACAAAAACAAACAAAA
CTTTGCTTACGTCACATCATTATCTGTGACTAATTCTTAATCATCATCATCATCATCACT
TACTTAAATCTAAAAAAATCTCTGTTTGTATATATATTATCTTTGCGATTTTTATCCAAA
TCTTCCAAAGCTTAGTTTTTTTTTTTTTCAAATGCTTTTTGGGGGTCCCGAATTTTATAA
CAAAACTTTT
GenBank Accession AL941031 [GenBank]
Graphic View Graphic view of sequence AL941031 of line 254B10
Predicted Position of Insertion Chr5:25996888 - go to primer design
BLAST e Value 1e-90
Hit Clone Code (BAC ID) F15O5
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL941032 [GenBank]


Last Updated on 07.07.2016 14:03