SimpleSearch - Line and FST details


Line specific information

 
Line ID 255H04
Vector Used pAC161
Line Availability available as T3 set from NASC (N424472)
Segregation Analysis 50:39:32
Confirmed for Hit At2g26150
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g26150

 
Sequence (A. th genome BLAST matches underlined) 
>32-K014576-022-255-H04-8409
NTGATCCATGTAGATTTCCCGAACATGAAGCACTTTAGCAGTCGTGAGGACGAGAGAATT
GAAACTACTACGGGGAGAGAAGAGAGGGGCCTACGGGACCCTCCCTATAGTGAGTAATTT
TAGCAACAAAATCAAAAATATCTACTTTTGTTTCTCGAAAGTTACGAAATTCATACAATC
TATGGGATCCTCCCTATAGTGAG
GenBank Accession AL941239 [GenBank]
Graphic View Graphic view of gene At2g26150
Predicted Position of Insertion Chr2:11135692 - go to primer design
BLAST e Value 2e-30
Hit Clone Code (BAC ID) T19L18
Hit Gene Code At2g26150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation heat shock transcription factor A2
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 10.06.2021 13:37