SimpleSearch - Line and FST details


Line specific information

 
Line ID 256E07
Vector Used pAC161
Line Availability only available from NASC (N424535)
Segregation Analysis 50:38:32
Confirmed for Hit At1g58060 At4g32880
Parent of DUPLO pair none
Parent of pair(s) 12862

Gene hit At1g58060

 
Sequence (A. th genome BLAST matches underlined)
>53-K014920-022-256-E07-8409
CTGATCCTGTAGATTTCCCGGAATGAAGCCCATCTGTAGCTGATCCACTAGCGCTTCACT
TTGGACTTTGTAATGTGCCCCCTACTTAGCAGAGACTCTATCTACATAATACTTTCTG
GenBank Accession FR806610 [GenBank]
Graphic View Graphic view of gene At1g58060
Predicted Position of Insertion Chr1:21496005 - go to primer design
BLAST e Value 1e-13
Hit Clone Code (BAC ID) T15M6
Hit Gene Code At1g58060 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNA helicase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g32880

 
Sequence (A. th genome BLAST matches underlined)
>53-K014917-022-256-E07-8409
TTGATCCATGTAGAATTTCCCGGNACATGAAGCACTACTAATAATGAGCCAACTACGTCA
ACATATTGGACTTCTAATGTCCCCCTTACTTAGCAGAGACTCTATCTACATAATACTTTC
TGCAAAAACGTGTTCTCTATGGGATCCTCCACTTAGTGAGGAAAAGGAATACAGGCGAGG
ATGCTTATATATACCCCTAAAAATGTGTGTTTGATCACGCTGGTATATGGAAGCAAAGGA
AGATATAGGAGTTTCTTGCTCTTGCTGTGAATACTACAAACCCATCTGAGAAATTTCTTT
CTCATACTCCAAATCCCTCTATATCTCTCAGGGGATGAGTAACTTCCTTCGGAAAAAACG
GTGAAGCATGCTTCAATGGGAACTACAAGATTCAAACCTCAGACTCTGCTACAGTTCAAC
CACTTTCTTCCTTAATCTGGCTCTCTCTTACTCATCTCTCTA
GenBank Accession AL941324 [GenBank]
Graphic View Graphic view of gene At4g32880
Predicted Position of Insertion Chr4:15868142 - go to primer design
BLAST e Value 1e-105
Hit Clone Code (BAC ID) T16I18
Hit Gene Code At4g32880 [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox gene 8
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23