SimpleSearch - Line and FST details


Line specific information

 
Line ID 273E01
Vector Used pAC161
Line Availability only available from NASC (N426161)
Segregation Analysis 50:47:38
Confirmed for Hit T7M7
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g20000

 
Sequence (A. th genome BLAST matches underlined)
>05-K015092-022-273-E01-8409
TTCATATTGAAGCACTTTTACATTTGGGCTTCTAAACATTAGGCTTGACACTAAATGGCC
TTTACGCAAGGTCTTGTTGTTTTGCTATGGGATCCTCCTATAGTGAGACTCTCATATATA
GAAGAGGGCTCGCGCAAGAGATTGGGAGAGTGCGCCACACCCCTCACCACTGGGGATATA
TCACATCTCC
GenBank Accession AL943318 [GenBank]
Graphic View Graphic view of gene At1g20000
Predicted Position of Insertion Chr1:6937708 - go to primer design
BLAST e Value 2e-18
Hit Clone Code (BAC ID) T20H2
Hit Gene Code At1g20000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TBP-associated factor 11B
Insertion Classification 5' region
Confirmation Status unknown

Gene hit T7M7

 
Sequence (A. th genome BLAST matches underlined)
>05-K015097-022-273-E01-8409
ACTTTTACTTTGGGCTTCTTAAAAATAGGCTTGACAATAAATGGCCTTTAACGCAAGGTC
TTGTTGTTTTAGCTATGGCATCCTCCCTATAGCGAGTCTTCCATGTAACTTCCGAGGCCG
CTGCTCATTTGTGTGATAGCGAACATACGCGGTAAGTGAAAGAGAAAAATACAAGAAGGG
ACATGACACTATAGACGCCTTCTTAATAAGAGAAGCACCGCCCTAATCGACCATTCACAA
CGATGACATTCAAACACTCTTCAGTTGCCCTTCCTTCTTGATTCGTCCTCTCCACTATTT
TTGTCAATTTCTTTAATCTCTCTCTTTCTCTCTCTACTTCCTCTTCCTCTTCTTCTTCTT
CTTCTTCTTCATCTATGGACCCTTTAGCTTCCCAACATCAACACAACCATCTGGAAGATA
ATAACCAAACCCTAACCCATAATAATCCTCAATCCGATTCCACCACCGACTCATCAACTT
CCTCCGCTCAACGCAAACGCAAAGGCAAAGGTGGTCCCGGACAACTCCAAGTTCCGTTAC
CGGGGCGTTCGACAAAGAAACTGGGGCAAATGGGTCGCCCAGATCCCAGACCCACGTAAG
CGC
GenBank Accession AL943319 [GenBank]
Graphic View Graphic view of sequence AL943319 of line 273E01
Predicted Position of Insertion Chr2:16797914 - go to primer design
BLAST e Value 4e-112
Hit Clone Code (BAC ID) T7M7
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03