SimpleSearch - Line and FST details


Line specific information

 
Line ID 277E09
Vector Used pAC161
Line Availability only available from NASC (N426553)
Segregation Analysis 100:100:91
Confirmed for Hit At1g07150
Parent of DUPLO pair 2555
Parent of pair(s) 1642

Gene hit At1g07150

 
Sequence (A. th genome BLAST matches underlined)
>56-K118809-0022-277-E09C-8409
CGGACATCTACATTTTTGAATTGAAAAAAAATTGGTAATTACTCTTTCTTTCATTTCAAG
TGGTTTCTTTTTCTCAGAATTTGTGGTGGTTTTACATTTATTAATGGAAATTATGGTTTA
TACTACATGTATCTTTAGGGAAATTGTTCTCACTATGTATTTGTTGTATCAGTATAATCA
AAGCAATAAACTCGAAACGTTGTCTTTTAATCACAGCCTCAAGTTTTGTTTGTTTGCACA
TGTGATTCGGATCGGACAAAACTATCTTTTACGCGGTGAGATGAGATCGAGTGTCTTAAT
TACGAGCCATTGCCTTATATTGATAACTCTCGTTTACAGCCAAATAGTTGTATTTTAATG
TGAAAAAATATTGCGACAAATGGTTTTGGTTCGTAAGCTGGTGGAAGACTCAAGAGGCCA
AAAGAGACT
GenBank Accession HG968860 [GenBank]
Graphic View Graphic view of gene At1g07150
Predicted Position of Insertion Chr1:2194560 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F10K1
Hit Gene Code At1g07150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitogen-activated protein kinase kinase kinase 13
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g53380

 
Sequence (A. th genome BLAST matches underlined)
>69-K015155-022-277-E09-8409
NTGATCCATGTAGCATTTCCCGGACATTGAAGCCTTTACAAATGGTGGGGTAGAGTTGTG
TTTATGTTTTTTTTTTTCCGGCCTTTTGAGCTTGGCCCCATTTCCTTCAAAAACCCCGAG
GCCATCTTTTACCGGGGGCCCATGGAACCTTATCCCTTTTTAAAAAAAAACGGAAAAATT
CCTTTCTGTTTCTAACCCTCCTTGGAAAAAAACAAACAAGGGACCGACTGGGGGAAACTC
TCCCAATTTTTAGGGGGATTAAAAAATTTCGCCTTCGACGGAAATTCAAATTCTTTTCTC
CCT
GenBank Accession AL943860 [GenBank]
Graphic View Graphic view of gene At1g53380
Predicted Position of Insertion Chr1:19913211 - go to primer design
BLAST e Value 3e-07
Hit Clone Code (BAC ID) F12M16
Hit Gene Code At1g53380 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plant protein of unknown function (DUF641)
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 07.07.2016 14:03