SimpleSearch - Line and FST details


Line specific information

 
Line ID 278E09
Vector Used pAC161
Line Availability only available from NASC (N426649)
Segregation Analysis 50:46:34
Confirmed for Hit At4g36220
Parent of DUPLO pair 2769
Parent of pair(s) none

Gene hit At4g36220

 
Sequence (A. th genome BLAST matches underlined)
>69-K015122-022-278-E09-8409
NTGATCCATGTAGATTNTCCCGGACCATGAAGCCTCTTACACTATGATCTTCTTGCTTTT
TACAGTGAAGAGGCCAAATTAGTCAGTGAGACAGCGGATCTTCAAAATTCCATCAAACTT
ACCCGTGACAATATCAAAGCAATCATCATGGTAATTATATTTCAAAAAGCGCTATGGGAT
CCTCCCAGTAGTGAGGAGATTGCAGCCTCACGAACCCCGGGCTCGGAGAACTAGGCC
GenBank Accession AL943982 [GenBank]
Graphic View Graphic view of gene At4g36220
Predicted Position of Insertion Chr4:17138656 - go to primer design
BLAST e Value 1e-65
Hit Clone Code (BAC ID) F23E13
Hit Gene Code At4g36220 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ferulic acid 5-hydroxylase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23