SimpleSearch - Line and FST details


Line specific information

 
Line ID 280A02
Vector Used pAC161
Line Availability only available from NASC (N426786)
Segregation Analysis 42:39:28
Confirmed for Hit At1g77950
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g77950

 
Sequence (A. th genome BLAST matches underlined)
>09-K015176-022-280-A02-8409
CTGATCCATGTAGAATTTCCCGGACCTGAANGCCTTTACAATTGAATATAATCATTCAGT
ATCCAAAGGATTTTAGTATATAAAAGTTGCAGAACATTTCAAAAATAGTAAGAGTTTCAG
GATTTCTTATGTAAATAGAAAAAATCGCTGCTGCGCTTTTCTATAAATAACAACAGAGTT
CGGGGTTATTTAGTAAATAGTAAAGGTATCGGATGTTCTCGGTAAATAGAGAAAGTTCCG
AAATACTTTGGAGATAGCCCCGGAACTTATAAAATAAAGAAACAGTCCGCAAACAATCTT
TAATTTTTGTTGTCAATTTGTTACAAAATAAACAAAAAAAAATCATTAGAAAACACCACA
AAATCAAGTGTTATATTAGCTTTCCAGTCGATTTAACATATAAAATTTCCACTTGTTAAA
CATTTTGAAGGATTTTTTGATAAATTTTCACCATTTGCTATTACAATAGTATATTATTTG
TTATTCCGACATGGCCATGCTCTGCTCTCTATGGGATCCTCCCTTAAGGGGAAGCNNNNN
NAAAAAAAATATTTGTTTCCCATTGTTTTTCCTTCCACAA
GenBank Accession AL944158 [GenBank]
Graphic View Graphic view of gene At1g77950
Predicted Position of Insertion Chr1:29307509 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F28K19
Hit Gene Code At1g77950 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 67
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03