SimpleSearch - Line and FST details


Line specific information

 
Line ID 288B01
Vector Used pAC161
Line Availability only available from NASC (N427565)
Segregation Analysis 100:98:68
Confirmed for Hit At3g10140
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g10140

 
Sequence (A. th genome BLAST matches underlined)
>02-K015346-022-288-B01-8409
TAGATCTCCTTTACAGTAGCATTGATGATTTGCCCAAGCTCCTGACTAAACAATGTCTCT
TGTGTTTACTCTTATCTTGCTTTGTAGCTGAATGGAAGAAGAAGCGTTTTGGCTTGCTCT
GGCTATGAAAATCGTTATCTTTCGTCTTTAGGTAATCACTAATTTCCTTTGTCTTTTGAT
TTCCATACTCTGTATCCTGTCTTTATGAGTGTGTTTCGTTTGGTCAGTTGAAGCTTCAGA
TTGTGAACTTGATGAAGTTCCAGATGATAGAAAAGTAGCGGAGAAAGACACTGCTCTACA
TTTAGCATTGTCACAGCTTTCAGGTGATTTTGATAAAGACTCTAAGTTGTCATTGCAGCG
GCTTTACAGAAAAAGGAGAGTTTCTGTGATATCCACGGGTTCCCTCAACCTTGATCTATG
GGATCCTCCAAAAAGGAAGGAATNGCCCTATNGGTCTTCTGAGACTGTATCTCTGATATT
ATCGGAGTAAACAAGCGTGTCGTGCTCCACCATGTGGACGAAGATTTTCTTCTTGTCATT
GAGTCGTACGAGACTCTGTATGAACTGTTCGCCAATCTTTACGGCGAGTTCTGTTAGGGC
CTCTATTTGAATCTTGGACTCCATGGGAATTGGGGATCCGCTA
GenBank Accession CR356297 [GenBank]
Graphic View Graphic view of gene At3g10140
Predicted Position of Insertion Chr3:3135157 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T22K18
Hit Gene Code At3g10140 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RECA homolog 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23