SimpleSearch - Line and FST details


Line specific information

 
Line ID 290D11
Vector Used pAC161
Line Availability only available from NASC (N427791)
Segregation Analysis 100:100:100
Confirmed for Hit At4g18240
Parent of DUPLO pair none
Parent of pair(s) 124

Gene hit At4g18240

Sequence (A. th genome BLAST matches underlined)
>84-K015348-022-290-D11-8409
NTGATCCATGTAGCATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGCATAA
GGGAAAGAAGAAAACAACACGCCCTTAGAAAGCAGCTTGGACTTTCTTCAGCGGAGTCAA
GACGGCCTTTGGTAACTTAATGTTTCCGCGAATACTGCGAGAGTCTTGAGCATACAGATT
CAGTTAATTTATTACACATTTATTTTGGTATAGGTTGGTTGCATAACAAGATTAGTACCA
CAGAAAGGAGTTCATCTAATCAGACATGCCATATACAGAACATTAGAGTTAGGTGGACAA
TTTGTACTTCTTGGTTCTATGGGATCCTCCCATAAAGGNGGAGANNNNANGANCCACCTT
NCTTTNGCACTATCTTCACAATAAAGAGACAGATAGCTGGGCGATGGAATACGAGGAGGT
TTCCGGATATTACCCTTTGTTGAGAAGTCTCAGTTGCCCTCTGGTACTTCTGAGACTGTA
TCTCTGATATTTTTGGAGTAGACAAGCGTGTCGTGCTCCACCATGTAGACGAAGATTTTC
TTCTTGTCATTGAGTCGTAAGAGACTCTGTATGAACTGTTCGCCAGTCTTATCGGGGAGT
TCTGTTAGGTCCTCTATGTGAATCTTTGACTCCATGGGAATTGGGGATCCTCTA
GenBank Accession AL945580 [GenBank]
Graphic View Graphic view of gene At4g18240
Predicted Position of Insertion Chr4:10085882 - go to primer design
BLAST e Value 2e-141
Hit Clone Code (BAC ID) T9A21
Hit Gene Code At4g18240 [TAIR] [MIPS] [SIGnAL]
Gene Annotation starch synthase 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Szydlowski et al. 2009, ssIV-1]
Other FSTs Supporting this Hit LN713411 [GenBank]


Last Updated on 14.10.2014 10:23