SimpleSearch - Line and FST details


Line specific information

 
Line ID 294B05
Vector Used pAC161
Line Availability only available from NASC (N428145)
Segregation Analysis 50:49:39
Confirmed for Hit At2g26510
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g26510

 
Sequence (A. th genome BLAST matches underlined)
>34-K015444-022-294-B05-8409
AACTTTTGATCCATATAGCTTTCTCCTGACTGAANGCCTTTACACTTGAATATATCCTGA
TTCTGGCGGATCATTACTGTGTGGAAATCGGTCTACCAATGCTGATTCTGTTGATCATAC
ACAGCAAGTCGGGCTTTTTATTATTTTCCGCGCTATATATGGTGGTGATTGTTTAGATAT
GTAATATTAAATCTTGCTACTGTTCATCTTGCAGTATCTTAAACATGCATTCTCAAGGAT
TTCTATGATTCTTGAAAGATATGCTTTACTTGTTTGCCTGGCTATCATATGGGCTTTTGC
TGCTATCCTTACTGTTTCTGGTGCTTATAATAATGTTTCTACCGCAACAAAACAAAGTTG
TCGAACTGATCGTGCCTTTCTTATGTCATCAGCTCCCTGGTAGGTTGATTACTATTTGAC
TTGATTCTTCTTTTCTTCTAAGGTCTAAATATCTTTATACTCAGTCACTCAAACTCATCT
TTCAGGATTAGAATCCCATATCCATTCCAGTGGGGGACTCCGATATTCAAAGCGAGTCAT
GTTTTTGGAATGTTTGGTGCTGCAATTGTCGCATCTGCAGAGGTTGTTATTCATCATATT
AGTTTCTAGGTGATCCATCCTANNNNAGAACGCNAGACGTTAATTTAACTCAAAATCATT
AATCGTTGCAACTAATCTACCGAAGACTCCGGCTTAAGAAGGAACGAAGACGGACGAATC
CGAGCCAAGGCCGTACAAGCGCGAGATACCTTCGGGACAGCCTA
GenBank Accession AL946105 [GenBank]
Graphic View Graphic view of gene At2g26510
Predicted Position of Insertion Chr2:11275634 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T9J22
Hit Gene Code At2g26510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Xanthine/uracil permease family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL946104 [GenBank]


Last Updated on 07.07.2016 14:03