SimpleSearch - Line and FST details


Line specific information

 
Line ID 314B12
Vector Used pAC161
Line Availability only available from NASC (N430072)
Segregation Analysis 50:16:16
Confirmed for Hit At1g79000
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g79000

 
Sequence (A. th genome BLAST matches underlined)
>90-K015819-022-314-B12-8409
TTCCTGTAATTTCCGGACATGAAGCCATTTACATTGAATATATCCTGTGCACATATCACT
CTGACTTGTGACAGGGAGAATCTGAGAACCTGCATGACGGTCTTCTGCATTGTTCTGGTA
TTGATTCTGAAACTGAGAAAGCTGAAATTGCTCAGGAGTTTGGGAGTGGATAGACTCGCT
ATGGGATCCTCCCTATAGTGAG
GenBank Accession AL948658 [GenBank]
Graphic View Graphic view of gene At1g79000
Predicted Position of Insertion Chr1:29721861 - go to primer design
BLAST e Value 6e-71
Hit Clone Code (BAC ID) YUP8H12R
Hit Gene Code At1g79000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone acetyltransferase of the CBP family 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL948658 [GenBank]


Last Updated on 31.08.2016 09:40