SimpleSearch - Line and FST details


Line specific information

 
Line ID 328D05
Vector Used pAC161
Line Availability only available from NASC (N431433)
Segregation Analysis 68:16:13
Confirmed for Hit At1g30100
Parent of DUPLO pair none
Parent of pair(s) 4191, 4215, 4268, 4296

Gene hit At1g30100

 
Sequence (A. th genome BLAST matches underlined)
>36-K016043-022-328-D05-8409
TGATCTGTNATTTCCCGGACTGAAGCCATTTAAATTGAATATATCCTGACACACGACGAC
TTTCCTGGTAGGCACCCCCCCTATGAGATCCGCCCTATAGAGAGAAATGGTGGGGCCCGT
GTACGGGGACTGAAAGATCGTTCAAGAGAATCGATTCGGTTCGCTTATCTTGCCCTAACG
AATGCGATATTCCATGGTCACTCTGGAAACCCCATGATGATGCTACTTTTCACACGGGTT
GTATGAGACTTATTCTATCGCAACTCCCTCTGGAGATGCTAACGCCGGTTTGGTTTACTT
CCACGACCGGTTATTAGCTATGTCTGAAGATGATCTACCTTACCAAGTTCGTGTCACTGA
CAATGGCGATTTAGAGACCATCGGAAGATTCGATTTCGACGGACAACTAAGCTCCGCCAT
GATCGCTCACCCGAAGATTGATCCGGTAACGAAGGAGCTATTTGCGTTGAGCTACGACGT
CGTTAAGAAACCGTATTTGAAATACTTTAAATTCTCGCCGGAAGGTGAGAAATCACCGGA
CGTTGAGATTCCTCTCGCCAGTCCGACGATGATGCACGATTTCGCGATCACTGAGAATTT
CGTTGTGATTCCGGATCAACAAGTTGTGTTTAAGCTCTCCGATATGTTTCTTGGGAAATC
TCCGGTTAAATACGACGGAGAGAAAATTTCCCGGTTTGGATTTTGCCTAG
GenBank Accession AL950414 [GenBank]
Graphic View Graphic view of gene At1g30100
Predicted Position of Insertion Chr1:10571872 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T2H7
Hit Gene Code At1g30100 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation nine-cis-epoxycarotenoid dioxygenase 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03