SimpleSearch - Line and FST details


Line specific information

 
Line ID 335D04
Vector Used pAC161
Line Availability only available from NASC (N432104)
Segregation Analysis 100:95:74
Confirmed for Hit MWD22
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At2g43010 can not be ordered because the confirmation of this insertion failed.

Gene hit At2g43010

 
Sequence (A. th genome BLAST matches underlined)
>28-K016067-022-335-D04-8409
TGTCATGTAGATTTCCCGGACTGAAGCCATTTACAATTGAAGCCATGTAGATTTCTAAAA
TGTCTTCTTCTTTTTTCATTTTATGTTTGTATGTGATGAATTATAAAGGAAAAAAGAATT
ACTGATCAGAAAATTTCGTACGATCTGTTTAATGAAGTCAATTTCTGATTTAAGAGACTA
TAAAAGTAACAAAATTTCATAAACTATTATAAAATCTGAGTAAGATCCTTAATCCAAAGT
TTAATACTATGGGATCCTCCCTATAGAGAGAGACAAGTGGTTCTGCACAGCCAAACTCAT
AGAGAACAAACCCTACCCCAGAAACGAAATCATTATGAAGAAGCCCTAAGATCCAGCACC
TTTCTTGAAGATCAAGAAACTGTCTCTTGGATCCAATACCCTCCAGATGAATACCCGTTC
GAACCCGAAGACTTCTCCTCCCACTTCTTCTCAACCATGGATCCCCTCCAGAGACCAACC
TCAGAGACGGCTAAGCCTAAGTCCAGTCCTGAACCTCCTCAAGTCATGGTTACGCCTAAG
GACTGTCCTGACCCTCCTCCTCTAGACATGCCTCCTCCAAGACTTAGGTATACTTATTCA
TCGTCGCCGGTTAAGGGAAACAGAAATGGAACAGTACTCGGTAACGACCGTTGGACCTAT
GG
GenBank Accession CT026272 [GenBank]
Graphic View Graphic view of gene At2g43010
Predicted Position of Insertion Chr2:17886983 - go to primer design
BLAST e Value 2e-159
Hit Clone Code (BAC ID) MFL8
Hit Gene Code At2g43010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation phytochrome interacting factor 4
Insertion Classification TS2TE (5')
Confirmation Status failed

Gene hit MWD22

 
Sequence (A. th genome BLAST matches underlined)
>39-K020162-022-335-D04t-8409
GTGACGAATTACAAAGGAAAAAAGAATTACCGATCAGAAAATTTCGTACGATCTGTTTAA
TGAAGTCAATTTCTGATTTAAGAGACTATAAAAGTAACAAAATTTCATAAACTATTATAA
AATCTGAGTAAGATCCTTAATCCAAAGTTTAATGCTATGGGATCCTCCCTATAGTGAGAC
TATGGGATCCTCCCTATANTGAGAGGTATNTCGAACTTCAACCACTCTAGGGTATCCTCC
CTTTCCAAAGAAAATGGGCCCCCCCGTGAAAGTAACAGATTCGGGCAAGAAGAAGAAACT
TACANCNTTGTACCTGCTCACGGTTATTTTGGCCGATTGATTTTCCAATATGCTATGGGA
TCCTCCCTATAGTGAGA
GenBank Accession BX530874 [GenBank]
Graphic View Graphic view of sequence BX530874 of line 335D04
Predicted Position of Insertion Chr5:20834238 - go to primer design
BLAST e Value 8e-74
Hit Clone Code (BAC ID) MWD22
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX530875 [GenBank]

Gene hit At3g31365

 
Sequence (A. th genome BLAST matches underlined)
>28-K016062-022-335-D04-8409
TGTCCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATATCCCCGGGGATCAAACG
AAAGACCTTATATGTTTGATATCTCATGCTATGGGATCCTCCCTATAGTGAGAAATTACT
GATCATAAAATTTCGTACCATCTGTGTAATGAAGTCTATATCTGATTTCAGAGACTATAA
AAGTAACTTAATTTCATAAACTATTATAAAATCTGAGTAAGATCCTTAATCCAAAGTTGA
ATACTAGTCCCATAAGAGACTCACGTTGTCATGGATTCTTTTTGGGCAAATGATCTGAAC
AAACGGGCGTCTCGTCGAACTCAAAGGCGTTTGTTTCTGACTCTGGATCGGAAGCGACAA
AGTATACTTAATTGCCTTCGATATCAAGAAACAAAGCATCTCCTGATAAGTGGTATATTT
TATATATAGATATTCCAAGGTTATTAATAACCGACATGCGCTATGGGATCCACCATATAG
TGAGATGGTCCCGATTTTTTTCTTTTCCCCTTGGAAATTACAATTCAAACTTTTCTTTTT
TGGA
GenBank Accession AL951319 [GenBank]
Graphic View Graphic view of gene At3g31365
Predicted Position of Insertion Chr3:12729582 - go to primer design
BLAST e Value 7e-64
Hit Clone Code (BAC ID) T22B15
Hit Gene Code At3g31365 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification TS2TE
Confirmation Status unknown


Last Updated on 07.07.2016 14:03