SimpleSearch - Line and FST details


Line specific information

 
Line ID 337A11
Vector Used pAC161
Line Availability only available from NASC (N432267)
Segregation Analysis 50:45:38
Confirmed for Hit At2g18420
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g18420

 
Sequence (A. th genome BLAST matches underlined)
>81-K016136-022-337-A11-8409
TGATCCTGTAATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTGCCGCCGCTGC
CGCTTTGCACCCGGTGGAGCGACAGAGTTTTTAAGGACACTTTCTGCGTCCTCCGTGGGT
GGTTAGGCTACCATAGCACGGACATTTGTCGTAGTTTCCGGATGTGCCCGGTGCCACGCA
GTTGCACCTATGGGATCCTCCCCTATAGTGAGAGTTGGTTTGGTTCCTGGTTAACATTAG
GTCTGAAAAGGTATTGTTTTTCATTATACAATTCACTAAATAGGCATCGTACTTGCATAT
AAAATAAAGAATGAAGAGAGAAGTAAAAGAGTTTTCTTTTTTTACTCATGGAAGTTAGGC
AATGGGTTTAAATATGGTAACAACAGAATTGGAGGGGACTTAATGAACTATGACGTAAAA
CTGAGAGCGATTGAATATGTAACGTTACCAACAATACCAATAAAATTATGAAAGATAGTA
TATGAAATTACGTTTAATTAATGTTTCCGGGTTGAATGTATTATATATAGAAGTAACAGT
ACGATTTTTATTACATTTTTGTACAAGATTCCTATGG
GenBank Accession AL951556 [GenBank]
Graphic View Graphic view of gene At2g18420
Predicted Position of Insertion Chr2:7994498 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T30D6
Hit Gene Code At2g18420 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Gibberellin-regulated family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g04550

 
Sequence (A. th genome BLAST matches underlined)
>81-K016158-022-337-A11-8409
TGATCCTGTAATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTGCCGCCGCTGC
CGCTTTGCACCCGGTGGAGCGACAGAGTTTTTAAGGACACTTTCTGCGTCCTCCGTGGGT
GGTTAGGCTACCATAGCACGGACATTTGTCGTAGTTTCCGGATGTGCCCGGTGCCACGCA
GTTGCACCTAGGCTTGCGAGGAAATGCAACGATCCCAAGTTGAAGTGCTTTGAGAATTGT
TTTAGTGATATGATGAAGACTGGAGCTGACCCTTATGGTTGGCAGTTTGGGTGGAAGAAA
ATGGATAAGAAAGCTAAGAAAATGGAACGTTTCATATCATCTAATGCTATGGGATCCTCC
CTAATAGTGAG
GenBank Accession AL951557 [GenBank]
Graphic View Graphic view of gene At5g04550
Predicted Position of Insertion Chr5:1305270 - go to primer design
BLAST e Value 2e-86
Hit Clone Code (BAC ID) T32M21
Hit Gene Code At5g04550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation type-1 restriction enzyme mjaxp r protein (DUF668)
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03