SimpleSearch - Line and FST details


Line specific information

 
Line ID 341D04
Vector Used pAC161
Line Availability only available from NASC (N432680)
Segregation Analysis 50:44:34
Confirmed for Hit At4g25100
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g25100

 
Sequence (A. th genome BLAST matches underlined)
>28-K016162-022-341-D04-8409
GATCCTGAAATTTCCCGGACATGAAGCAATTTACAATTGCTGATCCATCATACTCACTAC
TTTGAGTTTTGCATTTGAATCTGAAAGCATTGAGATAAGAGTAAGGAAGAAGTTAATATA
TTTATCTAAAGCTCTTAAACATTTGAAACACTTACAAGCAAGCCAGGCCCAGCCAGCTCC
AAACTGAGTGGCTGCAGCAGCATTGAACTCTTCATAGAACTTCTCATAAGAAGTGAAATC
TCTTTCAAGCAAAGCAAGAAGCTCTCCTGATGGTTTTCCTCCACCACCTGGTTTCATTGA
CTCCCAGAAGAACTCGTGGTTCCACGCCTATAAACATAACCAATGGATCATCAGCTAACC
AATCACACACCCATTTTATAATCTCAAACTAAAAATAGGTTTGTTAATTATCACCTGAGC
AGCGTTGTTGAAAGCAGGGAGGAGATCACCATTGTTGTAAGTGCTGTGGATAATGTGCTC
TAAGGGCTTGCCTTCAAGCTCGGTTCCAAGAACCTGTTTCTTGAGGTTGTCCACGTAAGC
TCTGTGATGTTTTCCCCAGTGAAACTCCAGAGTTTGTTTGCTCATATGCGGCTCCAAAGC
ATCCTTTCCAATTTTATATCAAAAAAACATTTCATCATATTGGCTATTGCTCTCACTCAT
GACTCAACCAATAGGTCCACTAT
GenBank Accession AL952154 [GenBank]
Graphic View Graphic view of gene At4g25100
Predicted Position of Insertion Chr4:12885129 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F13M23
Hit Gene Code At4g25100 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Fe superoxide dismutase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g17895

 
Sequence (A. th genome BLAST matches underlined)
>28-K016153-022-341-D04-8409
TTTCCCGGACTGAAGCCTTTACATTGATGATACCTCGAAGTTTTAATCGAAGGTGGTAAT
CGACATTTGGATCCCTGGGTACCCTGTCCTCGTCGAATGTAATGATCTTATCTTATATAT
CTGAAAGTTCTTGCCACTGACAATGAGATCGTGCCCCGTCACCTACGACTTTGGAGATTG
CACGTACATCCTCATGCTTTGAAAACTTGCTGGGAAAGACGTCTTTTTTCTCCATCCTCC
CCGGGGGCGCTGGTGATGGTTTTCCACCACTGTCGGGTTACGTATCCTCCCCGAAGGACT
TTCGTTTCCACCACTGTTGGCATTTGCAGGGGCCCCTCTCCTTTTCCACTATCTTCCAAT
GTATTGTCTCATAGTTGGGCTATGTTAGCCAATGATCGCCTCAGCAATGACCCTGTGAGC
AAGAAGCTCATTTGCCCTGTGGTCTTCGCAGACTGTATCGTTGTCATTTGTGGAG
GenBank Accession FR808229 [GenBank]
Graphic View Graphic view of gene At4g17895
Predicted Position of Insertion Chr4:9940634 - go to primer design
BLAST e Value 0.001
Hit Clone Code (BAC ID) T6K21
Hit Gene Code At4g17895 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ubiquitin-specific protease 20
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 14.10.2014 10:23