SimpleSearch - Line and FST details


Line specific information

 
Line ID 349D11
Vector Used pAC161
Line Availability only available from NASC (N433455)
Segregation Analysis 50:50:36
Confirmed for Hit At1g14920
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g14920

 
Sequence (A. th genome BLAST matches underlined)
>84-K016248-022-349-D11-8409
TGATCATGAGATTTCCNGGACATGAGCCATTTACAATTGATATATCCATGTAGAGTAATT
GCCGATCTCCGAAGCTAAAGATTCTTCACCTCTCCAAATAAAGCAAAACCTATGGGATCC
TCCCTATAGTGAGANNNNNNNNNNCNNNNNNNNTTNCNNTTTTTTTNNNGANNGNNATNG
GAATNTCCCTGATTATTATTGATCCATAATATTTAGGTTCGTGATGGGGGTCGATGCCCG
ATGAACCATGGATCCGAGGGCTAACCGCCACATCTACCGCTCAAAGAGATAAGGCTGAAA
ATCCCACACGCCCCTGCATTTGTAATTAGGGACTATATTGATCTCAATAAACTAATATAT
T
GenBank Accession AL953221 [GenBank]
Graphic View Graphic view of gene At1g14920
Predicted Position of Insertion Chr1:5149346 - go to primer design
BLAST e Value 1e-34
Hit Clone Code (BAC ID) F10B6
Hit Gene Code At1g14920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GRAS family transcription factor family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40