SimpleSearch - Line and FST details


Line specific information

 
Line ID 350G05
Vector Used pAC161
Line Availability only available from NASC (N433581)
Segregation Analysis 63:57:43
Confirmed for Hit At2g45310
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g45310

 
Sequence (A. th genome BLAST matches underlined)
>39-K016245-022-350-G05-8409
TATCCTGAAATTTCCCGGACATGAAGCCATTTACATTGAATATATACCTGGCCTTTTGCT
GGCCTTCACTTTCAATTAGTCTCTCCAATATCCTCACCAGATCTGAAACCGGCACCGGCG
ACGTGTTTCCGAGGATAAACACTCTCAATTGCGCCGGACCTCTCTTCTTCCCTCCACTCC
CTGTACTCTTCTCCGCCGTATCTATGGGATCCTCCCCTATAGAGAGATCACTTACATGTG
TGACCGGTTCCCAATGTACGGCTTTGGGTTCCCAATGTACGGGTTCCGGTTCCCAATGTA
CGGCTTTGGGTTCCCAATGTACGTGCTATCCACAGGAAAGAGACCTTTTCGACCTTTTTC
CCCTGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL953386 [GenBank]
Graphic View Graphic view of gene At2g45310
Predicted Position of Insertion Chr2:18683787 - go to primer design
BLAST e Value 5e-68
Hit Clone Code (BAC ID) F4L23
Hit Gene Code At2g45310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-D-glucuronate 4-epimerase 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR808555 [GenBank]


Last Updated on 07.07.2016 14:03