SimpleSearch - Line and FST details


Line specific information

 
Line ID 355B05
Vector Used pAC161
Line Availability only available from NASC (N434001)
Segregation Analysis 100:98:77
Confirmed for Hit At5g26680
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g26680

 
Sequence (A. th genome BLAST matches underlined)
>34-K016831-022-355-B05-8409
GATCTGTAGTTTCCCGGAATGAAGCCATTTATCTTGAATATATCCTGACTGAGAATTATT
ACCTTTCCTGACTTGCAAAGTGCAGCACATTGCGCTTCAGCCTCGGAAGTGGCCTGTATG
TAAGAAGCAACATCAGTCTTCTTTTCAAACTTTTAGCCATTTCATATCATAAACAAAAAG
ACGAGTTAATAGAAGAGATTTAGACCCTCGGGACTCTGCACATAACATAAGTACCTCAAC
AACAGGCACCCCCATGAGTCTCAAGAGTCTTTTGCAGTCATCATTATGCTGTTTTGTCAC
CTGGAGAGTGGAAATTTATACATATATTAATACGAGTCCTAGTCCAGTGGGAGAACCACA
ATTATGACCTCATGGATCTAAGCATGCAACTCGCGGGGAAGACGAGAAATTTATCGAAGA
GGGGGATTGATATGTCACCTCTTCCAAAAACCAATTGATTCACGCTATGGGATATCCNTT
CATGGTGTAGAGTGATGAATATCCATGGTCTGCCTCCAAGGCGTGGTGTCTGTGGGAAGT
GGGGTCACCCTGAAAATGGTAGTTTGG
GenBank Accession CR356308 [GenBank]
Graphic View Graphic view of gene At5g26680
Predicted Position of Insertion Chr5:9314095 - go to primer design
BLAST e Value 1e-158
Hit Clone Code (BAC ID) F21E10
Hit Gene Code At5g26680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 5'-3' exonuclease family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03