SimpleSearch - Line and FST details


Line specific information

 
Line ID 355H08
Vector Used pAC161
Line Availability only available from NASC (N434076)
Segregation Analysis 100:98:98
Confirmed for Hit At1g06290 At3g25250
Parent of DUPLO pair 2800
Parent of pair(s) 12592

Gene hit At1g06290

 
Sequence (A. th genome BLAST matches underlined)
>64-K016870-022-355-H08-8409
TGATCTGANATTTCCCGGACTGAAGCCATTTACAATTGGTAATTAATTTACGTCAAGCTA
TGATTTTTTTTCATTGTGGAGATGTGCTCTGCTTGGTATTAATCCTAATCTGAGATTGAA
AAGTTCAAATAGAAAGATTAATTTGTGCTTTGGTCAATGAAATGTGGTTATAGAATTTTG
AAGTTATTTAGCGTCCTATGGGATCTCCCCTATAGTGAGANNNNNNNNNNNNNNNNNNNN
NNNNTTTTNNNNNNNNNNNNNNNNNNNNCCCNCNCNNACANNAANNANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNCNNCCNNCNCNCNCCCNCNCCCCCCCCNN
CNNCCCATTTTTCTTCATAAAAATCCATTTTCATTACACTCACCTCTCCACCCCAACCCA
ACCTCACCACAACTACAAACCCAACCCAATTTACCCCATTATCCAATCAAACTCCTACAC
CCAAAACCTACTTTTTCACACCAACCTTAAACAAAAACC
GenBank Accession BX001418 [GenBank]
Graphic View Graphic view of gene At1g06290
Predicted Position of Insertion Chr1:1922934 - go to primer design
BLAST e Value 5e-68
Hit Clone Code (BAC ID) F9P14
Hit Gene Code At1g06290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation acyl-CoA oxidase 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g25250

 
Sequence (A. th genome BLAST matches underlined)
>11-K035333-022-355-H08C-8409
GCCGACTGCCTATAGAAGCCATTTACTAGCCGTAGGATCAACGTTGAGGAAATCAAGGGT
CATGATTTCTTCAGAGGAGTAGATTGGGAAAAGGTGATTTTGGTTTCTAGACCGCCGTAT
ATCCCGGCGCCGGACGACGGTGGTGATAAGGGAACCGATGTAAATACGAAGATGGATGTG
GAGAATATCGTCCAAGAGATTTTTGCTGCAAGACAAGAACGTGAGAAACAGAGTGGTGAT
AACAATAAAAACGCTAATATGAAAATTAAAGATAATACTAGTGGGGAATGGGTTAAGGGG
TTGAA
GenBank Accession HG968921 [GenBank]
Graphic View Graphic view of gene At3g25250
Predicted Position of Insertion Chr3:9196624 - go to primer design
BLAST e Value 2e-157
Hit Clone Code (BAC ID) MJL12
Hit Gene Code At3g25250 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGC (cAMP-dependent, cGMP-dependent and protein kinase C) kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HG968921 [GenBank]


Last Updated on 31.08.2016 09:40