SimpleSearch - Line and FST details


Line specific information

 
Line ID 357B06
Vector Used pAC161
Line Availability only available from NASC (N434194)
Segregation Analysis 50:49:49
Confirmed for Hit At3g66654
Parent of DUPLO pair 12337
Parent of pair(s) none

Gene hit At5g56770

 
Sequence (A. th genome BLAST matches underlined)
>42-K016834-022-357-B06-8409
TATCATGAAATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTGCAATTAACAGG
AAGAAACACATACCTAATATCTCGCGTATCAAAAAGCCATGTGCCAGCAACCAGTCTTCC
TTTGCAAATTTGACCCTCTTGTGTATCATTCATATCGAGTAGTTATGAATTGTAGGTTGA
TTTAGTGATATCTTGACAGGCTATCGTGGATCCTCGCCTATATGGAGAAAACAAAAATTC
CAAGAAGAGTACAAGAGGACTTAAGGATCAAAATCAGTCAATCAAGAAACTAAAGCTACT
TGAATCCTATCAAGCTATGGGATCCTCCCTTATAGTGAGANNNNNCNNTGGATTTNNNNA
TTTCCGCACTTTTAAAGAGCGTCTCGAAAATTAACTTTTATAGGTAGGAGGAGATAGAAA
TCGAATCTTATCGCCGCGTTAATATGCCACCGGCCGGAGAACTCCGACATCAATCTCCAT
CAAAGGAGAAACTATCTTCCGTTACCCAATCCGATGAAGCAGAAGCAGCGTCAGCAGCGA
TATCTGCGGCAGCTGCAAATGCGGAAGCTGCCGGATTATGGACACAGATCAAGGCGGAAG
CTCGCCGTGATGCTGAGGCGGAACCAGCTTTA
GenBank Accession BX001580 [GenBank]
Graphic View Graphic view of gene At5g56770
Predicted Position of Insertion Chr5:22962967 - go to primer design
BLAST e Value 3e-143
Hit Clone Code (BAC ID) MIK19
Hit Gene Code At5g56770 [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification 3' region
Confirmation Status unknown
Other FSTs Supporting this Hit BX001581 [GenBank]

Gene hit At3g66654

 
Sequence (A. th genome BLAST matches underlined)
>42-K016834-022-357-B06-8409
TATCATGAAATTTCCCGGACATGAAGCCATTTACATTGAATATATCCTGCAATTAACAGG
AAGAAACACATACCTAATATCTCGCGTATCAAAAAGCCATGTGCCAGCAACCAGTCTTCC
TTTGCAAATTTGACCCTCTTGTGTATCATTCATATCGAGTAGTTATGAATTGTAGGTTGA
TTTAGTGATATCTTGACAGGCTATCGTGGATCCTCGCCTATATGGAGAAAACAAAAATTC
CAAGAAGAGTACAAGAGGACTTAAGGATCAAAATCAGTCAATCAAGAAACTAAAGCTACT
TGAATCCTATCAAGCTATGGGATCCTCCCTTATAGTGAGANNNNNCNNTGGATTTNNNNA
TTTCCGCACTTTTAAAGAGCGTCTCGAAAATTAACTTTTATAGGTAGGAGGAGATAGAAA
TCGAATCTTATCGCCGCGTTAATATGCCACCGGCCGGAGAACTCCGACATCAATCTCCAT
CAAAGGAGAAACTATCTTCCGTTACCCAATCCGATGAAGCAGAAGCAGCGTCAGCAGCGA
TATCTGCGGCAGCTGCAAATGCGGAAGCTGCCGGATTATGGACACAGATCAAGGCGGAAG
CTCGCCGTGATGCTGAGGCGGAACCAGCTTTA
GenBank Accession BX001580 [GenBank]
Graphic View Graphic view of gene At3g66654
Predicted Position of Insertion Chr3:2089808 - go to primer design
BLAST e Value 6e-43
Hit Clone Code (BAC ID) T8E24
Hit Gene Code At3g66654 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cyclophilin-like peptidyl-prolyl cis-trans isomerase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23