SimpleSearch - Line and FST details


Line specific information

 
Line ID 364E01
Vector Used pAC161
Line Availability only available from NASC (N434897)
Segregation Analysis 100:98:71
Confirmed for Hit At3g20770
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g20770

 
Sequence (A. th genome BLAST matches underlined)
>05-K016996-022-364-E01-8409
TGATCTGTAATTTCCCGGACTGAAGCATTGACATTGAATATATCCACTCCCTTAGATATC
ATAAGCACCAATCACAGGCTGCCCATTCTCCGGAGATAATCCCATAAACAAAGCCGTGAG
ACTCTTACAAACTTCCATCATCGTCTACATATACTTCGAGATCCCAGTCTTGATGGTCTA
TGGGATCCTCCACTATAGTGAGATGGAGAAAGGAGTTCCTCCTCCGTGGTGGCCTAATGG
GAAAGAGGATTGGTGGCCTCAACTTGGTTTGCCTAAAGATCAAGGTCCTGCACCTTACAA
GAAGCCTCATGATTTGAAGAAGGCGTGGAAAGTCGGCGTTTTGACTGCGGTTATCAAGCA
TATGTTTCCTGATATTGCTAAGATCCGTAAGCTCGTGAGGCAATCTAAATGTTTGCAGGA
TAAGATGACTGCTAAAGAGAGTGCTACCTGGCTTGCTATTATTAACCAAGAAGAGTCCTT
GGCTATGGGATCCT
GenBank Accession BX002460 [GenBank]
Graphic View Graphic view of gene At3g20770
Predicted Position of Insertion Chr3:7262117 - go to primer design
BLAST e Value 4e-158
Hit Clone Code (BAC ID) MOE17
Hit Gene Code At3g20770 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ethylene insensitive 3 family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX002461 [GenBank]


Last Updated on 07.07.2016 14:03