SimpleSearch - Line and FST details


Line specific information

 
Line ID 368G05
Vector Used pAC161
Line Availability only available from NASC (N435309)
Segregation Analysis 150:111:94
Confirmed for Hit At3g63280 At5g02180
Parent of DUPLO pair none
Parent of pair(s) 9531, 58667, 78992, 78997, 79001, 79006, 92392

Gene hit At3g63280

 
Sequence (A. th genome BLAST matches underlined)
>39-K017047-022-368-G05-8409
TGATCTGAAATTTCCCGGACATGAAGCCATTTACATTGAGTCATTTACTCGGCTCCGAAG
GGTTTAAGCAGAACCCCGAGCTCATCGTACCGTTCCTGCTGCGAAAGCTTTGCACTGAAC
TCCAGCAGTCCCTCCAGAGCCTCCGCACGCTGCTGATACGATGACGTGTCGAACCTTCTC
TGTTTTACCTCCGAAACTGACCTTTTCTGTACAGTACACTTGTCCTTTGTGATCGAACCG
TTGGAATTGTCCTCACCATGAGGCGGACAAGGAGGAGAAGAAAAAGAGTGCCTATGGGA
GenBank Accession BX003014 [GenBank]
Graphic View Graphic view of gene At3g63280
Predicted Position of Insertion Chr3:23381299 - go to primer design
BLAST e Value 2e-132
Hit Clone Code (BAC ID) F16M2
Hit Gene Code At3g63280 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NIMA-related kinase 4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g02180

 
Sequence (A. th genome BLAST matches underlined)
>39-K017042-022-368-G05-8409
TGATCTGTNATTTCCCGGACATGAAGCATTTACAATTGAATATATCCTGATAGTTATGAG
TCTCGAAGAACTCATTCCAACAGCTAAGATGAGATCACGTGGTGTATCGATATTATTTAG
AACAATGCTATGGGATCTCNCCTATAGTGAGA
GenBank Accession BX003013 [GenBank]
Graphic View Graphic view of gene At5g02180
Predicted Position of Insertion Chr5:432950 - go to primer design
BLAST e Value 3e-38
Hit Clone Code (BAC ID) T7H20
Hit Gene Code At5g02180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Transmembrane amino acid transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03