SimpleSearch - Line and FST details


Line specific information

 
Line ID 376A06
Vector Used pAC161
Line Availability only available from NASC (N436006)
Segregation Analysis 50:49:40
Confirmed for Hit At2g20920
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g20920

 
Sequence (A. th genome BLAST matches underlined)
>41-K017162-022-376-A06-8409
ATATGACCGTCAGCATAGTCATCACCTGAAGATTCAAAGGAACTCCCATTCACATAAGTC
AAAACCTTCATGGCTCCTTTGACTCCAAATAAGGATGCGCGAGATCGCTCGTGGAAGGCA
TATCAACAGAGACAGGTGGATTCTTCATCCACTGAGTCACAGTACTTGTTCCCAGAGGGT
TACTATGGGATCCTCGCTATACTGAGATGTAANAAAAANNNNNTAATTTCCTATTTTGTG
TCCATATCGAAATCGCAAAGAGCGAAAAAAAACGGAACNGNCCNNCCAGGGCCGCGCGAA
CCTTCCCCACAGGACCCGGCCGCAGTTTTTGANTTTTTTTTCCCCCCCCCCCCCCCGCGG
GGGGAGGAGGGGGGGGGGGGNNGGGGGGGGGAAAAAAAAAAAAAAAAAAAGGGGGGGGGG
GGGGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNGGGNNCGNNNGGGGGGGGGGGGGG
GGGGGGGGAGGGGGNGGNGNGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAGG
GGGGGNNGGGGGGGGGGGGGAGNGGCGCCCGGCCANNGAAAGCGCCCCCCGCGGAAAGAA
AAGAGGGGGAGGGGGGGCGGGAAGCGAAGGAGAGGCGGGGCGCGAGGAGGGGAGAGGGGG
CGGGACCAAGGACAGAGGGGAACAGGGAGGCAGGGGGAACCGCCGAAAAGAAGGGAAAGG
GGGGGAAGAAGCGAGGGGCGAGGGGAGGAGCCGGAGGGAGGCGAAAGAGGAACGGGGCGC
AAGAGAAAGGGCGAGAAAAAAAAGAACAACGGGGGGGCGCGACGGCACAAACGGGCGACC
GGGGCGGCAACGGAAAAGAGAAAAAGG
GenBank Accession BX003937 [GenBank]
Graphic View Graphic view of gene At2g20920
Predicted Position of Insertion Chr2:8999469 - go to primer design
BLAST e Value 2e-55
Hit Clone Code (BAC ID) F5H14
Hit Gene Code At2g20920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein of unknown function (DUF3353)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX003938 [GenBank]


Last Updated on 07.07.2016 14:03